Incidental Mutation 'R8031:Fam3b'
ID 617982
Institutional Source Beutler Lab
Gene Symbol Fam3b
Ensembl Gene ENSMUSG00000022938
Gene Name family with sequence similarity 3, member B
Synonyms D16Jhu19e, 9030624C24Rik, ORF9, Pander
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 97470965-97514816 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 97481852 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 74 (Y74*)
Ref Sequence ENSEMBL: ENSMUSP00000062006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049721] [ENSMUST00000231414] [ENSMUST00000231641] [ENSMUST00000231999] [ENSMUST00000232018]
AlphaFold Q9D309
PDB Structure Long wavelength S-SAD structure of FAM3B PANDER [X-RAY DIFFRACTION]
Structure of FAM3B PANDER E30 construct [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000049721
AA Change: Y74*
SMART Domains Protein: ENSMUSP00000062006
Gene: ENSMUSG00000022938
AA Change: Y74*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:ILEI 107 200 3.6e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000231414
AA Change: Y85*
Predicted Effect probably benign
Transcript: ENSMUST00000231641
Predicted Effect probably null
Transcript: ENSMUST00000231999
AA Change: Y26*
Predicted Effect probably benign
Transcript: ENSMUST00000232018
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion of this gene display elevated blood glucose in glucose tolerance tests and elevated blood insulin after glucose injection, probably due to impaired insulin clearance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Fam3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fam3b APN 16 97478399 missense probably damaging 0.99
IGL01754:Fam3b APN 16 97476407 missense probably benign 0.00
IGL02582:Fam3b APN 16 97471191 nonsense probably null
R4393:Fam3b UTSW 16 97481786 critical splice donor site probably null
R4394:Fam3b UTSW 16 97481786 critical splice donor site probably null
R4395:Fam3b UTSW 16 97481786 critical splice donor site probably null
R6115:Fam3b UTSW 16 97475368 missense possibly damaging 0.47
R6388:Fam3b UTSW 16 97478391 missense probably benign 0.23
R6500:Fam3b UTSW 16 97500901 missense possibly damaging 0.78
R8411:Fam3b UTSW 16 97481853 missense probably benign 0.29
R8811:Fam3b UTSW 16 97512515 intron probably benign
R8992:Fam3b UTSW 16 97476394 missense probably damaging 0.97
R9128:Fam3b UTSW 16 97501000 missense probably benign
R9220:Fam3b UTSW 16 97500911 missense probably benign 0.02
Z1176:Fam3b UTSW 16 97481844 missense probably damaging 1.00
Z1177:Fam3b UTSW 16 97512487 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGTCTTAGCCTTGCCAGAG -3'
(R):5'- CAGGCGTGTGTCTTGAGAAG -3'

Sequencing Primer
(F):5'- CCTTGCCAGAGGTTAGGAACATAC -3'
(R):5'- TCTTGAGAAGAGTTCCCAGGATCC -3'
Posted On 2020-01-23