Incidental Mutation 'R8031:Fam3b'
ID 617982
Institutional Source Beutler Lab
Gene Symbol Fam3b
Ensembl Gene ENSMUSG00000022938
Gene Name FAM3 metabolism regulating signaling molecule B
Synonyms 9030624C24Rik, ORF9, D16Jhu19e, Pander
MMRRC Submission 067469-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 97272165-97306136 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 97283052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 74 (Y74*)
Ref Sequence ENSEMBL: ENSMUSP00000062006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049721] [ENSMUST00000231414] [ENSMUST00000231641] [ENSMUST00000231999] [ENSMUST00000232018]
AlphaFold Q9D309
PDB Structure Long wavelength S-SAD structure of FAM3B PANDER [X-RAY DIFFRACTION]
Structure of FAM3B PANDER E30 construct [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000049721
AA Change: Y74*
SMART Domains Protein: ENSMUSP00000062006
Gene: ENSMUSG00000022938
AA Change: Y74*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:ILEI 107 200 3.6e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000231414
AA Change: Y85*
Predicted Effect probably benign
Transcript: ENSMUST00000231641
Predicted Effect probably null
Transcript: ENSMUST00000231999
AA Change: Y26*
Predicted Effect probably benign
Transcript: ENSMUST00000232018
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion of this gene display elevated blood glucose in glucose tolerance tests and elevated blood insulin after glucose injection, probably due to impaired insulin clearance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,888,924 (GRCm39) probably null Het
Arhgdib A G 6: 136,901,274 (GRCm39) Y152H probably benign Het
Atxn10 T G 15: 85,277,594 (GRCm39) S354A probably benign Het
Cacng6 T C 7: 3,473,401 (GRCm39) V75A possibly damaging Het
Cdc23 A G 18: 34,784,741 (GRCm39) V7A unknown Het
Cdc40 T A 10: 40,728,512 (GRCm39) E157D probably benign Het
Defa25 T A 8: 21,575,253 (GRCm39) N77K probably benign Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Efcab3 T C 11: 104,772,295 (GRCm39) V2659A possibly damaging Het
Efcab6 T C 15: 83,867,699 (GRCm39) K260E possibly damaging Het
Eif4a3 T C 11: 119,179,731 (GRCm39) Y352C probably damaging Het
Erc2 A T 14: 27,733,649 (GRCm39) K566N probably damaging Het
Flg2 T A 3: 93,127,521 (GRCm39) S2144R unknown Het
Fmo4 G T 1: 162,626,421 (GRCm39) S375* probably null Het
Fsip2 A G 2: 82,817,235 (GRCm39) T4323A probably benign Het
Gm16503 A T 4: 147,625,767 (GRCm39) H87L unknown Het
Hes7 C T 11: 69,013,591 (GRCm39) A150V probably damaging Het
Hk1 T A 10: 62,132,478 (GRCm39) N190I probably benign Het
Il17rc A G 6: 113,459,782 (GRCm39) D576G probably damaging Het
Inhba T A 13: 16,200,860 (GRCm39) S141T possibly damaging Het
Itga8 G T 2: 12,160,297 (GRCm39) D840E probably benign Het
Kazn T C 4: 141,881,862 (GRCm39) E126G Het
Kcnk13 A G 12: 99,932,438 (GRCm39) Y78C probably damaging Het
Kcnt1 C A 2: 25,798,054 (GRCm39) probably benign Het
Krt42 G C 11: 100,155,865 (GRCm39) R294G possibly damaging Het
Myo9a A G 9: 59,687,374 (GRCm39) K160E probably benign Het
Nlrp1b T C 11: 71,107,747 (GRCm39) R585G probably benign Het
Ntrk2 T C 13: 59,022,193 (GRCm39) I416T probably benign Het
Or4c112 A T 2: 88,853,972 (GRCm39) I125N probably damaging Het
Or52h7 T A 7: 104,214,316 (GRCm39) I296N probably damaging Het
Or5k14 T C 16: 58,693,054 (GRCm39) N153S probably benign Het
Or8k33 G A 2: 86,384,447 (GRCm39) T7I probably damaging Het
P4ha3 A G 7: 99,941,905 (GRCm39) E106G probably damaging Het
Pcif1 A G 2: 164,728,442 (GRCm39) N233S probably damaging Het
Pgm2l1 C A 7: 99,921,625 (GRCm39) R619S probably damaging Het
Pkhd1l1 A G 15: 44,376,230 (GRCm39) Q964R probably damaging Het
Pla2g4a T A 1: 149,776,964 (GRCm39) I89F possibly damaging Het
Ppp1cc G A 5: 122,312,151 (GRCm39) A306T probably benign Het
Psmd4 T C 3: 94,943,203 (GRCm39) D67G probably damaging Het
Ptprt G A 2: 161,977,377 (GRCm39) T307I probably damaging Het
Rnf213 C A 11: 119,321,107 (GRCm39) C1188* probably null Het
Ror2 C T 13: 53,267,193 (GRCm39) C426Y probably damaging Het
Sacs C T 14: 61,441,640 (GRCm39) H1229Y probably damaging Het
Slc25a25 A T 2: 32,311,517 (GRCm39) L118Q probably damaging Het
Slc38a6 G A 12: 73,397,377 (GRCm39) A340T probably benign Het
Smarca5 A T 8: 81,431,311 (GRCm39) Y969N probably damaging Het
Sorbs1 C A 19: 40,314,933 (GRCm39) M626I probably benign Het
Spink5 T A 18: 44,143,303 (GRCm39) D753E probably benign Het
Taf1d T G 9: 15,221,695 (GRCm39) I226S probably damaging Het
Tmem225 A G 9: 40,060,689 (GRCm39) I83V possibly damaging Het
Top2b A G 14: 16,412,986 (GRCm38) D965G probably damaging Het
Traf3ip1 A G 1: 91,429,141 (GRCm39) K303E probably damaging Het
Ube2n C T 10: 95,377,244 (GRCm39) R70C probably benign Het
Ubl7 C T 9: 57,830,489 (GRCm39) P312S probably damaging Het
Vmn1r34 A T 6: 66,614,165 (GRCm39) M191K probably damaging Het
Vmn2r103 C T 17: 20,013,759 (GRCm39) H184Y probably benign Het
Vmn2r104 T C 17: 20,263,048 (GRCm39) I138V probably benign Het
Vmn2r49 T C 7: 9,720,408 (GRCm39) E361G possibly damaging Het
Vmn2r78 T C 7: 86,604,075 (GRCm39) L751P probably damaging Het
Zc3h13 T A 14: 75,568,070 (GRCm39) I1121N not run Het
Zfp235 T A 7: 23,841,114 (GRCm39) V511E probably benign Het
Other mutations in Fam3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fam3b APN 16 97,279,599 (GRCm39) missense probably damaging 0.99
IGL01754:Fam3b APN 16 97,277,607 (GRCm39) missense probably benign 0.00
IGL02582:Fam3b APN 16 97,272,391 (GRCm39) nonsense probably null
R4393:Fam3b UTSW 16 97,282,986 (GRCm39) critical splice donor site probably null
R4394:Fam3b UTSW 16 97,282,986 (GRCm39) critical splice donor site probably null
R4395:Fam3b UTSW 16 97,282,986 (GRCm39) critical splice donor site probably null
R6115:Fam3b UTSW 16 97,276,568 (GRCm39) missense possibly damaging 0.47
R6388:Fam3b UTSW 16 97,279,591 (GRCm39) missense probably benign 0.23
R6500:Fam3b UTSW 16 97,302,101 (GRCm39) missense possibly damaging 0.78
R8411:Fam3b UTSW 16 97,283,053 (GRCm39) missense probably benign 0.29
R8811:Fam3b UTSW 16 97,313,715 (GRCm39) intron probably benign
R8992:Fam3b UTSW 16 97,277,594 (GRCm39) missense probably damaging 0.97
R9128:Fam3b UTSW 16 97,302,200 (GRCm39) missense probably benign
R9220:Fam3b UTSW 16 97,302,111 (GRCm39) missense probably benign 0.02
Z1176:Fam3b UTSW 16 97,283,044 (GRCm39) missense probably damaging 1.00
Z1177:Fam3b UTSW 16 97,313,687 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGTCTTAGCCTTGCCAGAG -3'
(R):5'- CAGGCGTGTGTCTTGAGAAG -3'

Sequencing Primer
(F):5'- CCTTGCCAGAGGTTAGGAACATAC -3'
(R):5'- TCTTGAGAAGAGTTCCCAGGATCC -3'
Posted On 2020-01-23