Incidental Mutation 'R8031:Cdc23'
ID 617986
Institutional Source Beutler Lab
Gene Symbol Cdc23
Ensembl Gene ENSMUSG00000024370
Gene Name CDC23 cell division cycle 23
Synonyms D18Ertd243e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 34630951-34651735 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34651688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000122420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000025228
AA Change: V7A
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370
AA Change: V7A

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000133181
AA Change: V7A
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370
AA Change: V7A

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Cdc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cdc23 APN 18 34636332 missense probably benign 0.01
IGL01302:Cdc23 APN 18 34634644 missense probably benign 0.19
IGL01859:Cdc23 APN 18 34651406 missense probably benign 0.01
IGL02307:Cdc23 APN 18 34641389 missense possibly damaging 0.71
IGL03081:Cdc23 APN 18 34636704 missense probably damaging 1.00
IGL03086:Cdc23 APN 18 34637186 unclassified probably benign
IGL03089:Cdc23 APN 18 34634460 missense probably damaging 1.00
IGL03249:Cdc23 APN 18 34644016 splice site probably benign
R0217:Cdc23 UTSW 18 34651665 missense unknown
R0790:Cdc23 UTSW 18 34651613 missense possibly damaging 0.94
R1593:Cdc23 UTSW 18 34636326 missense possibly damaging 0.88
R2929:Cdc23 UTSW 18 34637318 frame shift probably null
R2930:Cdc23 UTSW 18 34637318 frame shift probably null
R3963:Cdc23 UTSW 18 34646919 missense probably benign 0.01
R3983:Cdc23 UTSW 18 34637486 unclassified probably benign
R4245:Cdc23 UTSW 18 34637047 unclassified probably benign
R4415:Cdc23 UTSW 18 34637318 frame shift probably null
R4417:Cdc23 UTSW 18 34637318 frame shift probably null
R4992:Cdc23 UTSW 18 34646919 missense probably benign
R5037:Cdc23 UTSW 18 34651689 missense unknown
R5071:Cdc23 UTSW 18 34651689 missense unknown
R5072:Cdc23 UTSW 18 34651689 missense unknown
R5073:Cdc23 UTSW 18 34651689 missense unknown
R5074:Cdc23 UTSW 18 34651689 missense unknown
R5081:Cdc23 UTSW 18 34651689 missense unknown
R5082:Cdc23 UTSW 18 34651689 missense unknown
R5083:Cdc23 UTSW 18 34651689 missense unknown
R5110:Cdc23 UTSW 18 34651689 missense unknown
R5111:Cdc23 UTSW 18 34651689 missense unknown
R5122:Cdc23 UTSW 18 34651689 missense unknown
R5131:Cdc23 UTSW 18 34651689 missense unknown
R5132:Cdc23 UTSW 18 34651689 missense unknown
R5166:Cdc23 UTSW 18 34651689 missense unknown
R7186:Cdc23 UTSW 18 34637122 missense probably damaging 1.00
R7359:Cdc23 UTSW 18 34641341 missense probably benign 0.40
R7732:Cdc23 UTSW 18 34636702 critical splice donor site probably null
R7832:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R8185:Cdc23 UTSW 18 34641144 missense probably benign 0.00
R8345:Cdc23 UTSW 18 34634097 missense probably benign 0.17
R8716:Cdc23 UTSW 18 34651682 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTAACGGTGCCCTTACCTC -3'
(R):5'- TTGCCAATCAGGATCTAACTGTC -3'

Sequencing Primer
(F):5'- TGCAGCTCCGACAAAGG -3'
(R):5'- AATCAGGATCTAACTGTCTCTTTTCC -3'
Posted On 2020-01-23