Incidental Mutation 'R8032:Aox2'
ID 617990
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58350283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1147 (Y1147F)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: Y1147F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: Y1147F

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,667,498 E60D probably benign Het
Adamts12 T C 15: 11,259,103 probably null Het
Ak9 T A 10: 41,424,620 C1609S unknown Het
Atf7ip T C 6: 136,565,112 F615L probably benign Het
BC005624 A G 2: 30,975,889 probably null Het
BC024063 T A 10: 82,107,904 M33K probably benign Het
Bmpr2 T A 1: 59,867,343 S532T probably benign Het
Cast G A 13: 74,735,241 Q292* probably null Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Ccdc155 TCAGGC TCAGGCACAGGC 7: 45,188,206 probably benign Het
Ccdc7a G T 8: 128,825,383 H1249N unknown Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Col15a1 T C 4: 47,288,108 I4T unknown Het
Cyp2c39 A G 19: 39,510,982 I38V probably benign Het
Dmpk A G 7: 19,088,053 D312G possibly damaging Het
Dnah1 T C 14: 31,271,548 D2892G probably damaging Het
Dnah10 G A 5: 124,746,612 D566N probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd2 T A 12: 80,489,653 D352E probably benign Het
Fgf8 A T 19: 45,737,237 L187Q probably damaging Het
Frrs1 A G 3: 116,878,360 I36V probably benign Het
Gga2 A T 7: 122,020,987 probably null Het
Gigyf2 C G 1: 87,407,013 H249D unknown Het
Gli2 A T 1: 118,836,170 M1417K probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm49380 A T 9: 44,111,703 I416N probably damaging Het
Gpr137 T C 19: 6,942,112 T16A unknown Het
Grid1 T A 14: 35,323,359 D386E probably benign Het
Grm3 A G 5: 9,512,272 V526A probably benign Het
Havcr2 A T 11: 46,479,291 I231F probably damaging Het
Icam5 C A 9: 21,033,218 R72S probably benign Het
Ighv9-2 T A 12: 114,109,144 I70L possibly damaging Het
Inpp5e C T 2: 26,396,853 S119N Het
Kxd1 T A 8: 70,514,141 D110V possibly damaging Het
Mbd4 A G 6: 115,844,633 S474P probably damaging Het
Meaf6 C A 4: 125,103,002 H168Q unknown Het
Nek2 T C 1: 191,826,345 L254S probably damaging Het
Nhej1 T C 1: 74,968,800 D104G probably benign Het
Nmnat3 A G 9: 98,410,218 E172G probably benign Het
Npm3 A T 19: 45,748,243 D152E probably benign Het
Nsd1 A T 13: 55,310,383 K2103M probably damaging Het
Ntrk3 C T 7: 78,356,059 R518H probably damaging Het
Nup210 T A 6: 91,074,349 T351S probably benign Het
Olfr1013 A G 2: 85,769,866 I22V probably benign Het
Olfr1564 T A 17: 33,215,950 R131S possibly damaging Het
Otof T A 5: 30,461,798 M1L probably benign Het
Pacs2 T A 12: 113,061,658 Y477N probably damaging Het
Panx3 A G 9: 37,661,670 Y195H probably damaging Het
Pcsk5 T C 19: 17,714,787 R178G probably damaging Het
Pde7a A G 3: 19,260,265 S56P possibly damaging Het
Prcp T G 7: 92,928,698 C392G probably damaging Het
Prkdc A G 16: 15,779,451 K2825R probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rbl1 A T 2: 157,187,998 Y468* probably null Het
Rbmxl2 A G 7: 107,210,222 Y238C probably damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Slc25a18 G A 6: 120,792,491 G237D probably damaging Het
Slc9a3 G A 13: 74,157,644 G260D probably damaging Het
Sorcs1 A T 19: 50,475,408 S201R probably benign Het
Strip1 A C 3: 107,618,078 D547E probably damaging Het
Thsd7a C T 6: 12,555,288 C199Y Het
Top1mt A G 15: 75,668,723 V233A probably damaging Het
Tpp2 C G 1: 43,975,468 P656A possibly damaging Het
Ttc1 A T 11: 43,737,979 L193Q probably damaging Het
Ttll4 T A 1: 74,696,473 D1013E possibly damaging Het
Unc5a T C 13: 54,996,486 V208A possibly damaging Het
Vmn1r185 C A 7: 26,611,133 V316F probably benign Het
Vmn2r112 T A 17: 22,603,394 V351E probably benign Het
Wdfy4 T A 14: 33,029,086 K2391* probably null Het
Zfhx3 T C 8: 108,951,222 V2968A possibly damaging Het
Zfp551 G A 7: 12,418,560 A82V possibly damaging Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCAGAGCAAGGCTTCTGTAC -3'
(R):5'- CCAGTGCCTTTAATCCTGTTTGAG -3'

Sequencing Primer
(F):5'- TCTGAGTTTGAGGCCAGCC -3'
(R):5'- TGGGCCTAGAATATACTCC -3'
Posted On 2020-01-23