Incidental Mutation 'R8032:Ttll4'
ID 617992
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R8032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74661745-74703730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74696473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1013 (D1013E)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678]
AlphaFold Q80UG8
Predicted Effect possibly damaging
Transcript: ENSMUST00000042125
AA Change: D1013E

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: D1013E

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113678
AA Change: D949E
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: D949E

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,667,498 E60D probably benign Het
Adamts12 T C 15: 11,259,103 probably null Het
Ak9 T A 10: 41,424,620 C1609S unknown Het
Aox2 A T 1: 58,350,283 Y1147F probably benign Het
Atf7ip T C 6: 136,565,112 F615L probably benign Het
BC005624 A G 2: 30,975,889 probably null Het
BC024063 T A 10: 82,107,904 M33K probably benign Het
Bmpr2 T A 1: 59,867,343 S532T probably benign Het
Cast G A 13: 74,735,241 Q292* probably null Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Ccdc155 TCAGGC TCAGGCACAGGC 7: 45,188,206 probably benign Het
Ccdc7a G T 8: 128,825,383 H1249N unknown Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Col15a1 T C 4: 47,288,108 I4T unknown Het
Cyp2c39 A G 19: 39,510,982 I38V probably benign Het
Dmpk A G 7: 19,088,053 D312G possibly damaging Het
Dnah1 T C 14: 31,271,548 D2892G probably damaging Het
Dnah10 G A 5: 124,746,612 D566N probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd2 T A 12: 80,489,653 D352E probably benign Het
Fgf8 A T 19: 45,737,237 L187Q probably damaging Het
Frrs1 A G 3: 116,878,360 I36V probably benign Het
Gga2 A T 7: 122,020,987 probably null Het
Gigyf2 C G 1: 87,407,013 H249D unknown Het
Gli2 A T 1: 118,836,170 M1417K probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm49380 A T 9: 44,111,703 I416N probably damaging Het
Gpr137 T C 19: 6,942,112 T16A unknown Het
Grid1 T A 14: 35,323,359 D386E probably benign Het
Grm3 A G 5: 9,512,272 V526A probably benign Het
Havcr2 A T 11: 46,479,291 I231F probably damaging Het
Icam5 C A 9: 21,033,218 R72S probably benign Het
Ighv9-2 T A 12: 114,109,144 I70L possibly damaging Het
Inpp5e C T 2: 26,396,853 S119N Het
Kxd1 T A 8: 70,514,141 D110V possibly damaging Het
Mbd4 A G 6: 115,844,633 S474P probably damaging Het
Meaf6 C A 4: 125,103,002 H168Q unknown Het
Nek2 T C 1: 191,826,345 L254S probably damaging Het
Nhej1 T C 1: 74,968,800 D104G probably benign Het
Nmnat3 A G 9: 98,410,218 E172G probably benign Het
Npm3 A T 19: 45,748,243 D152E probably benign Het
Nsd1 A T 13: 55,310,383 K2103M probably damaging Het
Ntrk3 C T 7: 78,356,059 R518H probably damaging Het
Nup210 T A 6: 91,074,349 T351S probably benign Het
Olfr1013 A G 2: 85,769,866 I22V probably benign Het
Olfr1564 T A 17: 33,215,950 R131S possibly damaging Het
Otof T A 5: 30,461,798 M1L probably benign Het
Pacs2 T A 12: 113,061,658 Y477N probably damaging Het
Panx3 A G 9: 37,661,670 Y195H probably damaging Het
Pcsk5 T C 19: 17,714,787 R178G probably damaging Het
Pde7a A G 3: 19,260,265 S56P possibly damaging Het
Prcp T G 7: 92,928,698 C392G probably damaging Het
Prkdc A G 16: 15,779,451 K2825R probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rbl1 A T 2: 157,187,998 Y468* probably null Het
Rbmxl2 A G 7: 107,210,222 Y238C probably damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Slc25a18 G A 6: 120,792,491 G237D probably damaging Het
Slc9a3 G A 13: 74,157,644 G260D probably damaging Het
Sorcs1 A T 19: 50,475,408 S201R probably benign Het
Strip1 A C 3: 107,618,078 D547E probably damaging Het
Thsd7a C T 6: 12,555,288 C199Y Het
Top1mt A G 15: 75,668,723 V233A probably damaging Het
Tpp2 C G 1: 43,975,468 P656A possibly damaging Het
Ttc1 A T 11: 43,737,979 L193Q probably damaging Het
Unc5a T C 13: 54,996,486 V208A possibly damaging Het
Vmn1r185 C A 7: 26,611,133 V316F probably benign Het
Vmn2r112 T A 17: 22,603,394 V351E probably benign Het
Wdfy4 T A 14: 33,029,086 K2391* probably null Het
Zfhx3 T C 8: 108,951,222 V2968A possibly damaging Het
Zfp551 G A 7: 12,418,560 A82V possibly damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 splice site probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 splice site probably null
R2876:Ttll4 UTSW 1 74686438 splice site probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74688661 missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74687259 missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74679413 missense probably benign 0.00
R7837:Ttll4 UTSW 1 74681757 critical splice acceptor site probably null
R8036:Ttll4 UTSW 1 74679230 missense probably benign 0.02
R8115:Ttll4 UTSW 1 74687330 nonsense probably null
R8949:Ttll4 UTSW 1 74681816 missense probably damaging 0.99
R9145:Ttll4 UTSW 1 74679790 missense probably benign 0.02
R9156:Ttll4 UTSW 1 74680066 missense probably benign 0.00
R9329:Ttll4 UTSW 1 74685962 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCCTGTATACATCATCAGGTGTC -3'
(R):5'- TAACTATGGCCTCCTGTGGG -3'

Sequencing Primer
(F):5'- TTTGTAGTCCCACGGGAGTCC -3'
(R):5'- GGCAAGACAGGCATATCACCTTTG -3'
Posted On 2020-01-23