Mutagenetix > Incidental Mutation

Incidental Mutation 'R8032:Ptpn12'

618009

Institutional Source

Beutler Lab

Gene Symbol

Ptpn12

Ensembl Gene

ENSMUSG00000028771

Gene Name

protein tyrosine phosphatase, non-receptor type 12

Synonyms

P19-PTP, PTP-PEST, PTP-P19

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8032 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20986645-21055911 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20998043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 579 (H579R)

Ref Sequence

ENSEMBL: ENSMUSP00000030556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813]

AlphaFold

P35831

Predicted Effect

probably benign
Transcript: ENSMUST00000030556
AA Change: H579R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: H579R

Domain	Start	End	E-Value	Type
PTPc	27	295	2.14e-126	SMART
Blast:PTPc	338	399	7e-12	BLAST
low complexity region	499	518	N/A	INTRINSIC
low complexity region	603	615	N/A	INTRINSIC
low complexity region	622	640	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148711

Predicted Effect

probably benign
Transcript: ENSMUST00000151813

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actrt2	T	A	4: 154,667,498	E60D	probably benign	Het
Adamts12	T	C	15: 11,259,103		probably null	Het
Ak9	T	A	10: 41,424,620	C1609S	unknown	Het
Aox2	A	T	1: 58,350,283	Y1147F	probably benign	Het
Atf7ip	T	C	6: 136,565,112	F615L	probably benign	Het
BC005624	A	G	2: 30,975,889		probably null	Het
BC024063	T	A	10: 82,107,904	M33K	probably benign	Het
Bmpr2	T	A	1: 59,867,343	S532T	probably benign	Het
Cast	G	A	13: 74,735,241	Q292*	probably null	Het
Ccdc155	CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC	CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC	7: 45,188,184		probably benign	Het
Ccdc155	TCAGGC	TCAGGCACAGGC	7: 45,188,206		probably benign	Het
Ccdc7a	G	T	8: 128,825,383	H1249N	unknown	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Col15a1	T	C	4: 47,288,108	I4T	unknown	Het
Cyp2c39	A	G	19: 39,510,982	I38V	probably benign	Het
Dmpk	A	G	7: 19,088,053	D312G	possibly damaging	Het
Dnah1	T	C	14: 31,271,548	D2892G	probably damaging	Het
Dnah10	G	A	5: 124,746,612	D566N	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Exd2	T	A	12: 80,489,653	D352E	probably benign	Het
Fgf8	A	T	19: 45,737,237	L187Q	probably damaging	Het
Frrs1	A	G	3: 116,878,360	I36V	probably benign	Het
Gga2	A	T	7: 122,020,987		probably null	Het
Gigyf2	C	G	1: 87,407,013	H249D	unknown	Het
Gli2	A	T	1: 118,836,170	M1417K	probably damaging	Het
Gm10801	C	CGTA	2: 98,663,807		probably null	Het
Gm49380	A	T	9: 44,111,703	I416N	probably damaging	Het
Gpr137	T	C	19: 6,942,112	T16A	unknown	Het
Grid1	T	A	14: 35,323,359	D386E	probably benign	Het
Grm3	A	G	5: 9,512,272	V526A	probably benign	Het
Havcr2	A	T	11: 46,479,291	I231F	probably damaging	Het
Icam5	C	A	9: 21,033,218	R72S	probably benign	Het
Ighv9-2	T	A	12: 114,109,144	I70L	possibly damaging	Het
Inpp5e	C	T	2: 26,396,853	S119N		Het
Kxd1	T	A	8: 70,514,141	D110V	possibly damaging	Het
Mbd4	A	G	6: 115,844,633	S474P	probably damaging	Het
Meaf6	C	A	4: 125,103,002	H168Q	unknown	Het
Nek2	T	C	1: 191,826,345	L254S	probably damaging	Het
Nhej1	T	C	1: 74,968,800	D104G	probably benign	Het
Nmnat3	A	G	9: 98,410,218	E172G	probably benign	Het
Npm3	A	T	19: 45,748,243	D152E	probably benign	Het
Nsd1	A	T	13: 55,310,383	K2103M	probably damaging	Het
Ntrk3	C	T	7: 78,356,059	R518H	probably damaging	Het
Nup210	T	A	6: 91,074,349	T351S	probably benign	Het
Olfr1013	A	G	2: 85,769,866	I22V	probably benign	Het
Olfr1564	T	A	17: 33,215,950	R131S	possibly damaging	Het
Otof	T	A	5: 30,461,798	M1L	probably benign	Het
Pacs2	T	A	12: 113,061,658	Y477N	probably damaging	Het
Panx3	A	G	9: 37,661,670	Y195H	probably damaging	Het
Pcsk5	T	C	19: 17,714,787	R178G	probably damaging	Het
Pde7a	A	G	3: 19,260,265	S56P	possibly damaging	Het
Prcp	T	G	7: 92,928,698	C392G	probably damaging	Het
Prkdc	A	G	16: 15,779,451	K2825R	probably benign	Het
Rbl1	A	T	2: 157,187,998	Y468*	probably null	Het
Rbmxl2	A	G	7: 107,210,222	Y238C	probably damaging	Het
Scgb2b20	A	T	7: 33,366,299	M1K	probably null	Het
Slc25a18	G	A	6: 120,792,491	G237D	probably damaging	Het
Slc9a3	G	A	13: 74,157,644	G260D	probably damaging	Het
Sorcs1	A	T	19: 50,475,408	S201R	probably benign	Het
Strip1	A	C	3: 107,618,078	D547E	probably damaging	Het
Thsd7a	C	T	6: 12,555,288	C199Y		Het
Top1mt	A	G	15: 75,668,723	V233A	probably damaging	Het
Tpp2	C	G	1: 43,975,468	P656A	possibly damaging	Het
Ttc1	A	T	11: 43,737,979	L193Q	probably damaging	Het
Ttll4	T	A	1: 74,696,473	D1013E	possibly damaging	Het
Unc5a	T	C	13: 54,996,486	V208A	possibly damaging	Het
Vmn1r185	C	A	7: 26,611,133	V316F	probably benign	Het
Vmn2r112	T	A	17: 22,603,394	V351E	probably benign	Het
Wdfy4	T	A	14: 33,029,086	K2391*	probably null	Het
Zfhx3	T	C	8: 108,951,222	V2968A	possibly damaging	Het
Zfp551	G	A	7: 12,418,560	A82V	possibly damaging	Het

Other mutations in Ptpn12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Ptpn12	APN	5	21029850	missense	probably damaging	1.00
IGL00226:Ptpn12	APN	5	20998668	missense	probably damaging	1.00
IGL01432:Ptpn12	APN	5	20998555	nonsense	probably null
IGL02285:Ptpn12	APN	5	21055713	missense	probably benign	0.40
IGL02488:Ptpn12	APN	5	21022062	missense	possibly damaging	0.72
IGL02550:Ptpn12	APN	5	20998139	missense	probably benign	0.00
IGL02640:Ptpn12	APN	5	21019246	missense	probably damaging	1.00
IGL02652:Ptpn12	APN	5	21002437	missense	probably benign	0.04
IGL03130:Ptpn12	APN	5	21002612	unclassified	probably benign
R0531:Ptpn12	UTSW	5	20998483	missense	possibly damaging	0.53
R0948:Ptpn12	UTSW	5	20998043	missense	probably benign
R1018:Ptpn12	UTSW	5	21029869	missense	possibly damaging	0.94
R1184:Ptpn12	UTSW	5	20998356	missense	possibly damaging	0.86
R1699:Ptpn12	UTSW	5	20998170	missense	probably benign	0.01
R1938:Ptpn12	UTSW	5	20993263	missense	probably damaging	1.00
R1952:Ptpn12	UTSW	5	20998310	missense	probably benign	0.34
R2152:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2153:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2154:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2267:Ptpn12	UTSW	5	20998411	missense	probably damaging	0.98
R2358:Ptpn12	UTSW	5	20998692	missense	probably damaging	1.00
R3551:Ptpn12	UTSW	5	20989049	missense	possibly damaging	0.67
R3931:Ptpn12	UTSW	5	21001323	missense	probably benign	0.00
R4013:Ptpn12	UTSW	5	20992743	missense	probably benign	0.05
R4039:Ptpn12	UTSW	5	21002510	nonsense	probably null
R4501:Ptpn12	UTSW	5	21019280	missense	probably damaging	1.00
R4748:Ptpn12	UTSW	5	21005385	nonsense	probably null
R4754:Ptpn12	UTSW	5	20998589	missense	probably benign	0.34
R4963:Ptpn12	UTSW	5	21015708	splice site	probably null
R5160:Ptpn12	UTSW	5	20997831	missense	probably damaging	1.00
R5581:Ptpn12	UTSW	5	21015726	missense	probably damaging	1.00
R5789:Ptpn12	UTSW	5	20989015	missense	possibly damaging	0.92
R5836:Ptpn12	UTSW	5	21009546	nonsense	probably null
R6383:Ptpn12	UTSW	5	20987468	nonsense	probably null
R6883:Ptpn12	UTSW	5	21055713	missense	probably benign	0.40
R7544:Ptpn12	UTSW	5	21009511	missense	probably damaging	1.00
R7885:Ptpn12	UTSW	5	20998525	missense	possibly damaging	0.54
R7915:Ptpn12	UTSW	5	21009451	missense	probably damaging	1.00
R7960:Ptpn12	UTSW	5	21055689	missense	probably benign	0.01
R7976:Ptpn12	UTSW	5	21002633	nonsense	probably null
R8224:Ptpn12	UTSW	5	20998658	missense	probably damaging	1.00
R8473:Ptpn12	UTSW	5	20998359	missense	probably benign	0.00
R8823:Ptpn12	UTSW	5	20998623	missense	probably damaging	1.00
R9375:Ptpn12	UTSW	5	21019214	missense	probably benign	0.21
R9613:Ptpn12	UTSW	5	20998623	missense	probably damaging	1.00
R9707:Ptpn12	UTSW	5	21002622	missense	probably damaging	0.99
X0004:Ptpn12	UTSW	5	21019296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTACTGGCAGGAGACACTG -3'
(R):5'- GGCTCATTCACACAGAGCTG -3'

Sequencing Primer
(F):5'- AGACACTGTGGCACTTGCTG -3'
(R):5'- TGAGTCGTCAGAGGAGTCC -3'

Posted On

2020-01-23