Mutagenetix > Incidental Mutations

Incidental Mutation 'R0659:Msh3'

61801

Institutional Source

Beutler Lab

Gene Symbol

Msh3

Ensembl Gene

ENSMUSG00000014850

Gene Name

mutS homolog 3

Synonyms

Rep3, Rep-3, D13Em1

MMRRC Submission

038844-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.247) question?

Stock #

R0659 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

92211872-92355003 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92345096 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 303 (N303D)

Ref Sequence

ENSEMBL: ENSMUSP00000140002 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000022220
AA Change: N303D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: N303D

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	1.6e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185852
AA Change: N303D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: N303D

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	7.2e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186878

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187831

Predicted Effect

probably benign
Transcript: ENSMUST00000187874

SMART Domains

Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189376

Predicted Effect

probably benign
Transcript: ENSMUST00000190393

SMART Domains

Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	241	6.4e-10	PFAM
low complexity region	261	285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191509

SMART Domains

Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191550

SMART Domains

Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Meta Mutation Damage Score

0.0905

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	G	18: 59,007,493		probably benign	Het
Ahnak	A	G	19: 9,015,002	H4550R	possibly damaging	Het
Anxa6	A	G	11: 54,983,347	V591A	probably damaging	Het
Apol7c	A	G	15: 77,526,273	S158P	probably damaging	Het
Asxl1	T	A	2: 153,400,724	S1065T	possibly damaging	Het
Cacna2d4	A	G	6: 119,345,106		probably benign	Het
Cd109	T	C	9: 78,680,170		probably benign	Het
Cep78	C	T	19: 15,956,190	V675M	probably damaging	Het
Ces4a	T	C	8: 105,144,922		probably benign	Het
Chpf	A	G	1: 75,477,723	V137A	probably damaging	Het
Comp	T	C	8: 70,379,101	S457P	possibly damaging	Het
Cth	A	G	3: 157,920,115		probably benign	Het
Cyp2a12	T	C	7: 27,034,138	L314P	probably damaging	Het
Ets1	C	T	9: 32,738,293	R309C	probably damaging	Het
Fam208b	T	C	13: 3,574,448	D1834G	probably damaging	Het
Foxp2	T	C	6: 15,254,279		probably benign	Het
Gm9875	T	G	2: 13,558,184	F108V	unknown	Het
Golga5	G	T	12: 102,476,208	V269F	possibly damaging	Het
Greb1	T	C	12: 16,680,212	Y1738C	probably damaging	Het
Grin2a	G	T	16: 9,992,472	P21Q	probably damaging	Het
Hdac5	A	T	11: 102,196,024	V70E	probably damaging	Het
Hdac9	T	C	12: 34,437,222	Q60R	probably damaging	Het
Hsd17b3	T	C	13: 64,073,936	T92A	possibly damaging	Het
Itpk1	C	T	12: 102,606,078		probably benign	Het
Lin28a	T	C	4: 134,008,099		probably benign	Het
Mapk6	T	C	9: 75,397,962	S58G	probably damaging	Het
Mmp21	G	A	7: 133,677,667		probably benign	Het
Mroh2a	G	A	1: 88,250,342	D1053N	probably damaging	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mto1	T	A	9: 78,457,508	I343N	probably damaging	Het
Mto1	C	T	9: 78,470,790	T638M	probably damaging	Het
Myo18b	T	C	5: 112,760,327	K2027E	possibly damaging	Het
Myo7a	T	C	7: 98,054,338		probably benign	Het
Nlrp9a	T	C	7: 26,557,278	I107T	probably damaging	Het
Olfr181	C	A	16: 58,926,409	R54L	possibly damaging	Het
Olfr970	T	G	9: 39,819,816	M59R	possibly damaging	Het
Osbpl5	A	G	7: 143,705,030	S268P	probably damaging	Het
Pih1d1	T	A	7: 45,159,975	S289T	probably benign	Het
Pik3c2b	A	G	1: 133,071,200	D353G	probably damaging	Het
Ppef2	A	G	5: 92,230,509	L609P	probably damaging	Het
Prune2	A	T	19: 17,122,835	D1901V	probably damaging	Het
Rdh9	T	C	10: 127,776,575	Y31H	possibly damaging	Het
Slc5a9	T	A	4: 111,883,871	Y526F	possibly damaging	Het
Slitrk5	A	G	14: 111,680,689	K582E	probably benign	Het
Sult1c2	A	T	17: 53,831,778	M257K	probably damaging	Het
Tmem132d	A	G	5: 127,984,287	I417T	possibly damaging	Het
Tmem229b	T	C	12: 78,965,134	T8A	probably benign	Het
Tmem237	T	C	1: 59,114,094	I89M	possibly damaging	Het
Tnfrsf17	A	T	16: 11,319,819	D140V	probably damaging	Het
Tnrc6b	T	A	15: 80,923,446		probably benign	Het
Trio	A	G	15: 27,831,399	L194P	probably damaging	Het
Vmn2r74	T	C	7: 85,955,914		probably benign	Het
Vps13c	T	A	9: 67,920,935	M1457K	probably benign	Het
Zfhx2	A	G	14: 55,073,801	C479R	possibly damaging	Het
Zfp420	T	A	7: 29,875,539	C395S	probably damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het
Zfp82	C	T	7: 30,056,329	E443K	probably damaging	Het
Zranb2	A	G	3: 157,541,763	S193G	probably benign	Het

Other mutations in Msh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Msh3	APN	13	92344964	missense	probably damaging	1.00
IGL00983:Msh3	APN	13	92300277	missense	probably damaging	1.00
IGL01490:Msh3	APN	13	92300305	missense	probably damaging	1.00
IGL02072:Msh3	APN	13	92300295	missense	probably damaging	1.00
IGL02313:Msh3	APN	13	92349312	missense	possibly damaging	0.86
IGL02711:Msh3	APN	13	92351311	missense	probably damaging	1.00
IGL03108:Msh3	APN	13	92221088	splice site	probably benign
IGL03227:Msh3	APN	13	92285960	missense	probably damaging	0.98
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0415:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
R0457:Msh3	UTSW	13	92220997	missense	probably damaging	1.00
R0661:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0686:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0688:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0707:Msh3	UTSW	13	92347340	nonsense	probably null
R1605:Msh3	UTSW	13	92300275	missense	probably null	1.00
R1622:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R1771:Msh3	UTSW	13	92212496	missense	probably benign	0.05
R1970:Msh3	UTSW	13	92249820	splice site	probably benign
R1971:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R1971:Msh3	UTSW	13	92249820	splice site	probably benign
R2894:Msh3	UTSW	13	92342360	missense	probably benign	0.16
R3837:Msh3	UTSW	13	92354858	missense	probably damaging	1.00
R4119:Msh3	UTSW	13	92354011	intron	probably benign
R4225:Msh3	UTSW	13	92285923	missense	probably benign	0.03
R4881:Msh3	UTSW	13	92266041	intron	probably benign
R5118:Msh3	UTSW	13	92309434	splice site	probably benign
R5209:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R5817:Msh3	UTSW	13	92286000	missense	possibly damaging	0.86
R5849:Msh3	UTSW	13	92249878	missense	possibly damaging	0.81
R5851:Msh3	UTSW	13	92215522	missense	probably benign	0.00
R5940:Msh3	UTSW	13	92249843	missense	probably damaging	1.00
R6004:Msh3	UTSW	13	92342414	critical splice acceptor site	probably null
R6363:Msh3	UTSW	13	92212524	missense	probably damaging	1.00
R6510:Msh3	UTSW	13	92353264	nonsense	probably null
R6654:Msh3	UTSW	13	92345042	missense	probably benign	0.01
R6853:Msh3	UTSW	13	92312572	critical splice donor site	probably null
R7022:Msh3	UTSW	13	92235588	missense	probably damaging	1.00
R7098:Msh3	UTSW	13	92274111	missense	possibly damaging	0.95
R7103:Msh3	UTSW	13	92274800	missense	probably benign
R7148:Msh3	UTSW	13	92354822	missense	probably benign	0.18
R7171:Msh3	UTSW	13	92349298	missense	probably benign	0.00
R7317:Msh3	UTSW	13	92286004	missense	probably damaging	1.00
R7369:Msh3	UTSW	13	92299262	missense	probably benign	0.15
R7586:Msh3	UTSW	13	92349332	utr 3 prime	probably benign
R7641:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R7648:Msh3	UTSW	13	92274028	missense	probably damaging	1.00
R7674:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R8125:Msh3	UTSW	13	92299182	missense	probably benign
R8252:Msh3	UTSW	13	92221061	missense	probably damaging	1.00
R8388:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R8442:Msh3	UTSW	13	92212512	missense	probably benign	0.00
R8735:Msh3	UTSW	13	92274866	missense	possibly damaging	0.94
R8986:Msh3	UTSW	13	92346826	missense	probably damaging	1.00
R9264:Msh3	UTSW	13	92349304	missense	probably benign	0.00
R9326:Msh3	UTSW	13	92263799	missense	probably benign	0.15
R9457:Msh3	UTSW	13	92345086	missense	probably benign	0.04
R9459:Msh3	UTSW	13	92215539	missense	possibly damaging	0.91
S24628:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
X0027:Msh3	UTSW	13	92274070	missense	probably damaging	0.98
X0063:Msh3	UTSW	13	92274785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCACCTTCCAAGGACTTACCACG -3'
(R):5'- GGTTGTTAAGGAGTCAAGTGCCACG -3'

Sequencing Primer
(F):5'- ACGATACCAACGGAAAGGTTC -3'
(R):5'- TCCCACATGGTTGCAGGTG -3'

Posted On

2013-07-30