Incidental Mutation 'R8032:Panx3'
ID618032
Institutional Source Beutler Lab
Gene Symbol Panx3
Ensembl Gene ENSMUSG00000011118
Gene Namepannexin 3
Synonyms4833413G11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8032 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37659902-37669235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37661670 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 195 (Y195H)
Ref Sequence ENSEMBL: ENSMUSP00000011262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011262] [ENSMUST00000117654] [ENSMUST00000142228] [ENSMUST00000142736]
Predicted Effect probably damaging
Transcript: ENSMUST00000011262
AA Change: Y195H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011262
Gene: ENSMUSG00000011118
AA Change: Y195H

DomainStartEndE-ValueType
Pfam:Innexin 33 270 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117654
SMART Domains Protein: ENSMUSP00000112600
Gene: ENSMUSG00000011114

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
coiled coil region 56 79 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 124 156 N/A INTRINSIC
FYRN 192 235 1.05e-18 SMART
Pfam:FYRC 238 316 1.4e-23 PFAM
low complexity region 349 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142228
Predicted Effect probably benign
Transcript: ENSMUST00000142736
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are known to be the structural components of gap junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against surgically induced osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,667,498 E60D probably benign Het
Adamts12 T C 15: 11,259,103 probably null Het
Ak9 T A 10: 41,424,620 C1609S unknown Het
Aox2 A T 1: 58,350,283 Y1147F probably benign Het
Atf7ip T C 6: 136,565,112 F615L probably benign Het
BC005624 A G 2: 30,975,889 probably null Het
BC024063 T A 10: 82,107,904 M33K probably benign Het
Bmpr2 T A 1: 59,867,343 S532T probably benign Het
Cast G A 13: 74,735,241 Q292* probably null Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Ccdc155 TCAGGC TCAGGCACAGGC 7: 45,188,206 probably benign Het
Ccdc7a G T 8: 128,825,383 H1249N unknown Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Col15a1 T C 4: 47,288,108 I4T unknown Het
Cyp2c39 A G 19: 39,510,982 I38V probably benign Het
Dmpk A G 7: 19,088,053 D312G possibly damaging Het
Dnah1 T C 14: 31,271,548 D2892G probably damaging Het
Dnah10 G A 5: 124,746,612 D566N probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd2 T A 12: 80,489,653 D352E probably benign Het
Fgf8 A T 19: 45,737,237 L187Q probably damaging Het
Frrs1 A G 3: 116,878,360 I36V probably benign Het
Gga2 A T 7: 122,020,987 probably null Het
Gigyf2 C G 1: 87,407,013 H249D unknown Het
Gli2 A T 1: 118,836,170 M1417K probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm49380 A T 9: 44,111,703 I416N probably damaging Het
Gpr137 T C 19: 6,942,112 T16A unknown Het
Grid1 T A 14: 35,323,359 D386E probably benign Het
Grm3 A G 5: 9,512,272 V526A probably benign Het
Havcr2 A T 11: 46,479,291 I231F probably damaging Het
Icam5 C A 9: 21,033,218 R72S probably benign Het
Ighv9-2 T A 12: 114,109,144 I70L possibly damaging Het
Inpp5e C T 2: 26,396,853 S119N Het
Kxd1 T A 8: 70,514,141 D110V possibly damaging Het
Mbd4 A G 6: 115,844,633 S474P probably damaging Het
Meaf6 C A 4: 125,103,002 H168Q unknown Het
Nek2 T C 1: 191,826,345 L254S probably damaging Het
Nhej1 T C 1: 74,968,800 D104G probably benign Het
Nmnat3 A G 9: 98,410,218 E172G probably benign Het
Npm3 A T 19: 45,748,243 D152E probably benign Het
Nsd1 A T 13: 55,310,383 K2103M probably damaging Het
Ntrk3 C T 7: 78,356,059 R518H probably damaging Het
Nup210 T A 6: 91,074,349 T351S probably benign Het
Olfr1013 A G 2: 85,769,866 I22V probably benign Het
Olfr1564 T A 17: 33,215,950 R131S possibly damaging Het
Otof T A 5: 30,461,798 M1L probably benign Het
Pacs2 T A 12: 113,061,658 Y477N probably damaging Het
Pcsk5 T C 19: 17,714,787 R178G probably damaging Het
Pde7a A G 3: 19,260,265 S56P possibly damaging Het
Prcp T G 7: 92,928,698 C392G probably damaging Het
Prkdc A G 16: 15,779,451 K2825R probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rbl1 A T 2: 157,187,998 Y468* probably null Het
Rbmxl2 A G 7: 107,210,222 Y238C probably damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Slc25a18 G A 6: 120,792,491 G237D probably damaging Het
Slc9a3 G A 13: 74,157,644 G260D probably damaging Het
Sorcs1 A T 19: 50,475,408 S201R probably benign Het
Strip1 A C 3: 107,618,078 D547E probably damaging Het
Thsd7a C T 6: 12,555,288 C199Y Het
Top1mt A G 15: 75,668,723 V233A probably damaging Het
Tpp2 C G 1: 43,975,468 P656A possibly damaging Het
Ttc1 A T 11: 43,737,979 L193Q probably damaging Het
Ttll4 T A 1: 74,696,473 D1013E possibly damaging Het
Unc5a T C 13: 54,996,486 V208A possibly damaging Het
Vmn1r185 C A 7: 26,611,133 V316F probably benign Het
Vmn2r112 T A 17: 22,603,394 V351E probably benign Het
Wdfy4 T A 14: 33,029,086 K2391* probably null Het
Zfhx3 T C 8: 108,951,222 V2968A possibly damaging Het
Zfp551 G A 7: 12,418,560 A82V possibly damaging Het
Other mutations in Panx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Panx3 APN 9 37661471 missense probably damaging 1.00
IGL01371:Panx3 APN 9 37661475 missense probably benign 0.03
IGL01458:Panx3 APN 9 37661147 missense probably damaging 0.99
IGL01637:Panx3 APN 9 37664056 missense probably damaging 0.98
R1693:Panx3 UTSW 9 37668907 missense possibly damaging 0.64
R1693:Panx3 UTSW 9 37668946 missense possibly damaging 0.88
R1708:Panx3 UTSW 9 37661391 missense probably benign 0.00
R1818:Panx3 UTSW 9 37664026 missense probably benign 0.04
R2142:Panx3 UTSW 9 37666673 missense probably damaging 1.00
R5386:Panx3 UTSW 9 37669024 missense probably damaging 0.99
R5981:Panx3 UTSW 9 37668881 missense possibly damaging 0.93
R6273:Panx3 UTSW 9 37667429 missense probably benign 0.01
R6429:Panx3 UTSW 9 37661165 missense probably damaging 1.00
R6768:Panx3 UTSW 9 37664026 missense probably benign 0.04
R7082:Panx3 UTSW 9 37666617 missense probably benign 0.25
R7165:Panx3 UTSW 9 37664085 missense probably damaging 1.00
R7173:Panx3 UTSW 9 37661300 missense probably damaging 0.99
R7494:Panx3 UTSW 9 37661312 missense probably damaging 1.00
R7629:Panx3 UTSW 9 37661444 missense possibly damaging 0.83
R7650:Panx3 UTSW 9 37661405 missense probably damaging 0.97
R8383:Panx3 UTSW 9 37666753 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTAGCAGCCCTGTCTTG -3'
(R):5'- CTCCTCTGGTGGAAGAACTG -3'

Sequencing Primer
(F):5'- TAGCAGCCCTGTCTTGATGAAGC -3'
(R):5'- TCAGCAGTTAAAAGCACTGGC -3'
Posted On2020-01-23