Incidental Mutation 'R8032:Adamts12'
ID 618049
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 11259189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably null
Transcript: ENSMUST00000061318
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,751,955 (GRCm39) E60D probably benign Het
Ak9 T A 10: 41,300,616 (GRCm39) C1609S unknown Het
Aox1 A T 1: 58,389,442 (GRCm39) Y1147F probably benign Het
Atf7ip T C 6: 136,542,110 (GRCm39) F615L probably benign Het
BC005624 A G 2: 30,865,901 (GRCm39) probably null Het
BC024063 T A 10: 81,943,738 (GRCm39) M33K probably benign Het
Bmpr2 T A 1: 59,906,502 (GRCm39) S532T probably benign Het
Cast G A 13: 74,883,360 (GRCm39) Q292* probably null Het
Ccdc7a G T 8: 129,551,864 (GRCm39) H1249N unknown Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Col15a1 T C 4: 47,288,108 (GRCm39) I4T unknown Het
Cyp2c39 A G 19: 39,499,426 (GRCm39) I38V probably benign Het
Dmpk A G 7: 18,821,978 (GRCm39) D312G possibly damaging Het
Dnah1 T C 14: 30,993,505 (GRCm39) D2892G probably damaging Het
Dnah10 G A 5: 124,823,676 (GRCm39) D566N probably damaging Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Exd2 T A 12: 80,536,427 (GRCm39) D352E probably benign Het
Fgf8 A T 19: 45,725,676 (GRCm39) L187Q probably damaging Het
Frrs1 A G 3: 116,672,009 (GRCm39) I36V probably benign Het
Gga2 A T 7: 121,620,210 (GRCm39) probably null Het
Gigyf2 C G 1: 87,334,735 (GRCm39) H249D unknown Het
Gli2 A T 1: 118,763,900 (GRCm39) M1417K probably damaging Het
Gm10801 C CGTA 2: 98,494,152 (GRCm39) probably null Het
Gm49380 A T 9: 44,023,000 (GRCm39) I416N probably damaging Het
Gpr137 T C 19: 6,919,480 (GRCm39) T16A unknown Het
Grid1 T A 14: 35,045,316 (GRCm39) D386E probably benign Het
Grm3 A G 5: 9,562,272 (GRCm39) V526A probably benign Het
Havcr2 A T 11: 46,370,118 (GRCm39) I231F probably damaging Het
Icam5 C A 9: 20,944,514 (GRCm39) R72S probably benign Het
Ighv9-2 T A 12: 114,072,764 (GRCm39) I70L possibly damaging Het
Inpp5e C T 2: 26,286,865 (GRCm39) S119N Het
Kash5 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 44,837,608 (GRCm39) probably benign Het
Kash5 TCAGGC TCAGGCACAGGC 7: 44,837,630 (GRCm39) probably benign Het
Kxd1 T A 8: 70,966,791 (GRCm39) D110V possibly damaging Het
Mbd4 A G 6: 115,821,594 (GRCm39) S474P probably damaging Het
Meaf6 C A 4: 124,996,795 (GRCm39) H168Q unknown Het
Nek2 T C 1: 191,558,457 (GRCm39) L254S probably damaging Het
Nhej1 T C 1: 75,007,959 (GRCm39) D104G probably benign Het
Nmnat3 A G 9: 98,292,271 (GRCm39) E172G probably benign Het
Npm3 A T 19: 45,736,682 (GRCm39) D152E probably benign Het
Nsd1 A T 13: 55,458,196 (GRCm39) K2103M probably damaging Het
Ntrk3 C T 7: 78,005,807 (GRCm39) R518H probably damaging Het
Nup210 T A 6: 91,051,331 (GRCm39) T351S probably benign Het
Or10h5 T A 17: 33,434,924 (GRCm39) R131S possibly damaging Het
Or9g19 A G 2: 85,600,210 (GRCm39) I22V probably benign Het
Otof T A 5: 30,619,142 (GRCm39) M1L probably benign Het
Pacs2 T A 12: 113,025,278 (GRCm39) Y477N probably damaging Het
Panx3 A G 9: 37,572,966 (GRCm39) Y195H probably damaging Het
Pcsk5 T C 19: 17,692,151 (GRCm39) R178G probably damaging Het
Pde7a A G 3: 19,314,429 (GRCm39) S56P possibly damaging Het
Prcp T G 7: 92,577,906 (GRCm39) C392G probably damaging Het
Prkdc A G 16: 15,597,315 (GRCm39) K2825R probably benign Het
Ptpn12 T C 5: 21,203,041 (GRCm39) H579R probably benign Het
Rbl1 A T 2: 157,029,918 (GRCm39) Y468* probably null Het
Rbmxl2 A G 7: 106,809,429 (GRCm39) Y238C probably damaging Het
Scgb2b20 A T 7: 33,065,724 (GRCm39) M1K probably null Het
Slc25a18 G A 6: 120,769,452 (GRCm39) G237D probably damaging Het
Slc9a3 G A 13: 74,305,763 (GRCm39) G260D probably damaging Het
Sorcs1 A T 19: 50,463,846 (GRCm39) S201R probably benign Het
Strip1 A C 3: 107,525,394 (GRCm39) D547E probably damaging Het
Thsd7a C T 6: 12,555,287 (GRCm39) C199Y Het
Top1mt A G 15: 75,540,572 (GRCm39) V233A probably damaging Het
Tpp2 C G 1: 44,014,628 (GRCm39) P656A possibly damaging Het
Ttc1 A T 11: 43,628,806 (GRCm39) L193Q probably damaging Het
Ttll4 T A 1: 74,735,632 (GRCm39) D1013E possibly damaging Het
Unc5a T C 13: 55,144,299 (GRCm39) V208A possibly damaging Het
Vmn1r185 C A 7: 26,310,558 (GRCm39) V316F probably benign Het
Vmn2r112 T A 17: 22,822,375 (GRCm39) V351E probably benign Het
Wdfy4 T A 14: 32,751,043 (GRCm39) K2391* probably null Het
Zfhx3 T C 8: 109,677,854 (GRCm39) V2968A possibly damaging Het
Zfp551 G A 7: 12,152,487 (GRCm39) A82V possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTGTAAATGTCTTCTGGC -3'
(R):5'- GACTTCAGTGCCAAGTTAAAACATG -3'

Sequencing Primer
(F):5'- GGAATCTTCCTGACATACATCCTCAC -3'
(R):5'- CCTCCAAGAATGACGTCA -3'
Posted On 2020-01-23