Incidental Mutation 'R0659:Zfp740'
ID61805
Institutional Source Beutler Lab
Gene Symbol Zfp740
Ensembl Gene ENSMUSG00000046897
Gene Namezinc finger protein 740
Synonyms
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R0659 (G1)
Quality Score173
Status Validated
Chromosome15
Chromosomal Location102203249-102215606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102212659 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000155827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001327] [ENSMUST00000118729] [ENSMUST00000119168] [ENSMUST00000119800] [ENSMUST00000121206] [ENSMUST00000133986] [ENSMUST00000139960] [ENSMUST00000141465] [ENSMUST00000229886] [ENSMUST00000230867]
Predicted Effect probably benign
Transcript: ENSMUST00000001327
SMART Domains Protein: ENSMUSP00000001327
Gene: ENSMUSG00000001281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 44 92 6.35e-6 SMART
INB 50 476 2.82e-273 SMART
VWA 151 383 7.52e-2 SMART
low complexity region 537 557 N/A INTRINSIC
Pfam:EGF_2 605 635 2.6e-7 PFAM
Integrin_B_tail 645 721 4.22e-18 SMART
low complexity region 732 744 N/A INTRINSIC
Integrin_b_cyt 746 792 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118729
AA Change: T161A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112985
Gene: ENSMUSG00000046897
AA Change: T161A

DomainStartEndE-ValueType
low complexity region 53 62 N/A INTRINSIC
ZnF_C2H2 76 98 3.07e-1 SMART
ZnF_C2H2 104 126 1.69e-3 SMART
ZnF_C2H2 132 152 4.99e1 SMART
Predicted Effect silent
Transcript: ENSMUST00000119168
Predicted Effect probably benign
Transcript: ENSMUST00000119800
AA Change: T173A

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113770
Gene: ENSMUSG00000046897
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
ZnF_C2H2 88 110 3.07e-1 SMART
ZnF_C2H2 116 138 1.69e-3 SMART
ZnF_C2H2 144 164 4.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119830
SMART Domains Protein: ENSMUSP00000113281
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
ZnF_C2H2 25 47 3.07e-1 SMART
ZnF_C2H2 53 75 1.69e-3 SMART
ZnF_C2H2 81 101 4.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123528
Predicted Effect probably benign
Transcript: ENSMUST00000133986
SMART Domains Protein: ENSMUSP00000122429
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139960
SMART Domains Protein: ENSMUSP00000117024
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
Blast:ZnF_C2H2 88 107 9e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141465
Predicted Effect probably benign
Transcript: ENSMUST00000229440
Predicted Effect probably benign
Transcript: ENSMUST00000229886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230550
Predicted Effect possibly damaging
Transcript: ENSMUST00000230867
AA Change: T136A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Zfp740
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Zfp740 APN 15 102212674 missense possibly damaging 0.66
R0432:Zfp740 UTSW 15 102212659 missense possibly damaging 0.66
R0661:Zfp740 UTSW 15 102212659 missense possibly damaging 0.66
R1666:Zfp740 UTSW 15 102208318 missense probably damaging 1.00
R1830:Zfp740 UTSW 15 102207901 missense probably damaging 1.00
R3983:Zfp740 UTSW 15 102208243 missense probably benign 0.06
R4686:Zfp740 UTSW 15 102208749 unclassified probably benign
R4991:Zfp740 UTSW 15 102208279 unclassified probably null
R5170:Zfp740 UTSW 15 102209205 missense probably damaging 1.00
R5213:Zfp740 UTSW 15 102212647 missense possibly damaging 0.68
R5782:Zfp740 UTSW 15 102208366 unclassified probably benign
R6088:Zfp740 UTSW 15 102208808 missense probably damaging 1.00
R6848:Zfp740 UTSW 15 102208808 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACACAGTGTATGTCCCCTCTGAGAC -3'
(R):5'- TTAGCTGCCAGTTCCAGTCCAAGG -3'

Sequencing Primer
(F):5'- TATGTCCCCTCTGAGACAGGAAC -3'
(R):5'- TGGGATACTCATAGCCTCAGACTG -3'
Posted On2013-07-30