Incidental Mutation 'R8032:Olfr1564'
ID618053
Institutional Source Beutler Lab
Gene Symbol Olfr1564
Ensembl Gene ENSMUSG00000096169
Gene Nameolfactory receptor 1564
SynonymsGm4461
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R8032 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33211206-33221690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33215950 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 131 (R131S)
Ref Sequence ENSEMBL: ENSMUSP00000150267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112162] [ENSMUST00000208645] [ENSMUST00000213642] [ENSMUST00000213751] [ENSMUST00000215450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112162
AA Change: R134S

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127247
Gene: ENSMUSG00000096169
AA Change: R134S

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 263 1.5e-5 PFAM
Pfam:7tm_1 44 297 5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208645
AA Change: R131S

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213642
AA Change: R131S

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213751
AA Change: R131S

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215450
AA Change: R131S

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,667,498 E60D probably benign Het
Adamts12 T C 15: 11,259,103 probably null Het
Ak9 T A 10: 41,424,620 C1609S unknown Het
Aox2 A T 1: 58,350,283 Y1147F probably benign Het
Atf7ip T C 6: 136,565,112 F615L probably benign Het
BC005624 A G 2: 30,975,889 probably null Het
BC024063 T A 10: 82,107,904 M33K probably benign Het
Bmpr2 T A 1: 59,867,343 S532T probably benign Het
Cast G A 13: 74,735,241 Q292* probably null Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Ccdc155 TCAGGC TCAGGCACAGGC 7: 45,188,206 probably benign Het
Ccdc7a G T 8: 128,825,383 H1249N unknown Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Col15a1 T C 4: 47,288,108 I4T unknown Het
Cyp2c39 A G 19: 39,510,982 I38V probably benign Het
Dmpk A G 7: 19,088,053 D312G possibly damaging Het
Dnah1 T C 14: 31,271,548 D2892G probably damaging Het
Dnah10 G A 5: 124,746,612 D566N probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Exd2 T A 12: 80,489,653 D352E probably benign Het
Fgf8 A T 19: 45,737,237 L187Q probably damaging Het
Frrs1 A G 3: 116,878,360 I36V probably benign Het
Gga2 A T 7: 122,020,987 probably null Het
Gigyf2 C G 1: 87,407,013 H249D unknown Het
Gli2 A T 1: 118,836,170 M1417K probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm49380 A T 9: 44,111,703 I416N probably damaging Het
Gpr137 T C 19: 6,942,112 T16A unknown Het
Grid1 T A 14: 35,323,359 D386E probably benign Het
Grm3 A G 5: 9,512,272 V526A probably benign Het
Havcr2 A T 11: 46,479,291 I231F probably damaging Het
Icam5 C A 9: 21,033,218 R72S probably benign Het
Ighv9-2 T A 12: 114,109,144 I70L possibly damaging Het
Inpp5e C T 2: 26,396,853 S119N Het
Kxd1 T A 8: 70,514,141 D110V possibly damaging Het
Mbd4 A G 6: 115,844,633 S474P probably damaging Het
Meaf6 C A 4: 125,103,002 H168Q unknown Het
Nek2 T C 1: 191,826,345 L254S probably damaging Het
Nhej1 T C 1: 74,968,800 D104G probably benign Het
Nmnat3 A G 9: 98,410,218 E172G probably benign Het
Npm3 A T 19: 45,748,243 D152E probably benign Het
Nsd1 A T 13: 55,310,383 K2103M probably damaging Het
Ntrk3 C T 7: 78,356,059 R518H probably damaging Het
Nup210 T A 6: 91,074,349 T351S probably benign Het
Olfr1013 A G 2: 85,769,866 I22V probably benign Het
Otof T A 5: 30,461,798 M1L probably benign Het
Pacs2 T A 12: 113,061,658 Y477N probably damaging Het
Panx3 A G 9: 37,661,670 Y195H probably damaging Het
Pcsk5 T C 19: 17,714,787 R178G probably damaging Het
Pde7a A G 3: 19,260,265 S56P possibly damaging Het
Prcp T G 7: 92,928,698 C392G probably damaging Het
Prkdc A G 16: 15,779,451 K2825R probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rbl1 A T 2: 157,187,998 Y468* probably null Het
Rbmxl2 A G 7: 107,210,222 Y238C probably damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Slc25a18 G A 6: 120,792,491 G237D probably damaging Het
Slc9a3 G A 13: 74,157,644 G260D probably damaging Het
Sorcs1 A T 19: 50,475,408 S201R probably benign Het
Strip1 A C 3: 107,618,078 D547E probably damaging Het
Thsd7a C T 6: 12,555,288 C199Y Het
Top1mt A G 15: 75,668,723 V233A probably damaging Het
Tpp2 C G 1: 43,975,468 P656A possibly damaging Het
Ttc1 A T 11: 43,737,979 L193Q probably damaging Het
Ttll4 T A 1: 74,696,473 D1013E possibly damaging Het
Unc5a T C 13: 54,996,486 V208A possibly damaging Het
Vmn1r185 C A 7: 26,611,133 V316F probably benign Het
Vmn2r112 T A 17: 22,603,394 V351E probably benign Het
Wdfy4 T A 14: 33,029,086 K2391* probably null Het
Zfhx3 T C 8: 108,951,222 V2968A possibly damaging Het
Zfp551 G A 7: 12,418,560 A82V possibly damaging Het
Other mutations in Olfr1564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1564 APN 17 33215973 missense probably benign 0.41
R0079:Olfr1564 UTSW 17 33216105 missense probably benign 0.14
R0939:Olfr1564 UTSW 17 33215661 missense possibly damaging 0.72
R1279:Olfr1564 UTSW 17 33216326 missense possibly damaging 0.59
R2167:Olfr1564 UTSW 17 33215568 missense probably damaging 0.97
R2866:Olfr1564 UTSW 17 33216278 missense probably benign 0.22
R4738:Olfr1564 UTSW 17 33215810 missense probably benign 0.03
R4976:Olfr1564 UTSW 17 33215754 missense probably benign 0.35
R6452:Olfr1564 UTSW 17 33215945 missense probably benign 0.03
R6721:Olfr1564 UTSW 17 33215534 missense probably benign
R7322:Olfr1564 UTSW 17 33215699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACTTCAATAGAGGTGGAAC -3'
(R):5'- TGGAGTGAACACAGTCTCCAC -3'

Sequencing Primer
(F):5'- CTTCAATAGAGGTGGAACATGGC -3'
(R):5'- GAGATTTTCTACACCTTTGCCATC -3'
Posted On2020-01-23