Mutagenetix > Incidental Mutation

Incidental Mutation 'R8032:Dsc2'

618054

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8032 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20032274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 881 (G881R)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably benign
Transcript: ENSMUST00000039247

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.1423

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actrt2	T	A	4: 154,667,498	E60D	probably benign	Het
Adamts12	T	C	15: 11,259,103		probably null	Het
Ak9	T	A	10: 41,424,620	C1609S	unknown	Het
Aox2	A	T	1: 58,350,283	Y1147F	probably benign	Het
Atf7ip	T	C	6: 136,565,112	F615L	probably benign	Het
BC005624	A	G	2: 30,975,889		probably null	Het
BC024063	T	A	10: 82,107,904	M33K	probably benign	Het
Bmpr2	T	A	1: 59,867,343	S532T	probably benign	Het
Cast	G	A	13: 74,735,241	Q292*	probably null	Het
Ccdc155	CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC	CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC	7: 45,188,184		probably benign	Het
Ccdc155	TCAGGC	TCAGGCACAGGC	7: 45,188,206		probably benign	Het
Ccdc7a	G	T	8: 128,825,383	H1249N	unknown	Het
Cd177	C	T	7: 24,756,169	W309*	probably null	Het
Col15a1	T	C	4: 47,288,108	I4T	unknown	Het
Cyp2c39	A	G	19: 39,510,982	I38V	probably benign	Het
Dmpk	A	G	7: 19,088,053	D312G	possibly damaging	Het
Dnah1	T	C	14: 31,271,548	D2892G	probably damaging	Het
Dnah10	G	A	5: 124,746,612	D566N	probably damaging	Het
Exd2	T	A	12: 80,489,653	D352E	probably benign	Het
Fgf8	A	T	19: 45,737,237	L187Q	probably damaging	Het
Frrs1	A	G	3: 116,878,360	I36V	probably benign	Het
Gga2	A	T	7: 122,020,987		probably null	Het
Gigyf2	C	G	1: 87,407,013	H249D	unknown	Het
Gli2	A	T	1: 118,836,170	M1417K	probably damaging	Het
Gm10801	C	CGTA	2: 98,663,807		probably null	Het
Gm49380	A	T	9: 44,111,703	I416N	probably damaging	Het
Gpr137	T	C	19: 6,942,112	T16A	unknown	Het
Grid1	T	A	14: 35,323,359	D386E	probably benign	Het
Grm3	A	G	5: 9,512,272	V526A	probably benign	Het
Havcr2	A	T	11: 46,479,291	I231F	probably damaging	Het
Icam5	C	A	9: 21,033,218	R72S	probably benign	Het
Ighv9-2	T	A	12: 114,109,144	I70L	possibly damaging	Het
Inpp5e	C	T	2: 26,396,853	S119N		Het
Kxd1	T	A	8: 70,514,141	D110V	possibly damaging	Het
Mbd4	A	G	6: 115,844,633	S474P	probably damaging	Het
Meaf6	C	A	4: 125,103,002	H168Q	unknown	Het
Nek2	T	C	1: 191,826,345	L254S	probably damaging	Het
Nhej1	T	C	1: 74,968,800	D104G	probably benign	Het
Nmnat3	A	G	9: 98,410,218	E172G	probably benign	Het
Npm3	A	T	19: 45,748,243	D152E	probably benign	Het
Nsd1	A	T	13: 55,310,383	K2103M	probably damaging	Het
Ntrk3	C	T	7: 78,356,059	R518H	probably damaging	Het
Nup210	T	A	6: 91,074,349	T351S	probably benign	Het
Olfr1013	A	G	2: 85,769,866	I22V	probably benign	Het
Olfr1564	T	A	17: 33,215,950	R131S	possibly damaging	Het
Otof	T	A	5: 30,461,798	M1L	probably benign	Het
Pacs2	T	A	12: 113,061,658	Y477N	probably damaging	Het
Panx3	A	G	9: 37,661,670	Y195H	probably damaging	Het
Pcsk5	T	C	19: 17,714,787	R178G	probably damaging	Het
Pde7a	A	G	3: 19,260,265	S56P	possibly damaging	Het
Prcp	T	G	7: 92,928,698	C392G	probably damaging	Het
Prkdc	A	G	16: 15,779,451	K2825R	probably benign	Het
Ptpn12	T	C	5: 20,998,043	H579R	probably benign	Het
Rbl1	A	T	2: 157,187,998	Y468*	probably null	Het
Rbmxl2	A	G	7: 107,210,222	Y238C	probably damaging	Het
Scgb2b20	A	T	7: 33,366,299	M1K	probably null	Het
Slc25a18	G	A	6: 120,792,491	G237D	probably damaging	Het
Slc9a3	G	A	13: 74,157,644	G260D	probably damaging	Het
Sorcs1	A	T	19: 50,475,408	S201R	probably benign	Het
Strip1	A	C	3: 107,618,078	D547E	probably damaging	Het
Thsd7a	C	T	6: 12,555,288	C199Y		Het
Top1mt	A	G	15: 75,668,723	V233A	probably damaging	Het
Tpp2	C	G	1: 43,975,468	P656A	possibly damaging	Het
Ttc1	A	T	11: 43,737,979	L193Q	probably damaging	Het
Ttll4	T	A	1: 74,696,473	D1013E	possibly damaging	Het
Unc5a	T	C	13: 54,996,486	V208A	possibly damaging	Het
Vmn1r185	C	A	7: 26,611,133	V316F	probably benign	Het
Vmn2r112	T	A	17: 22,603,394	V351E	probably benign	Het
Wdfy4	T	A	14: 33,029,086	K2391*	probably null	Het
Zfhx3	T	C	8: 108,951,222	V2968A	possibly damaging	Het
Zfp551	G	A	7: 12,418,560	A82V	possibly damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'

Posted On

2020-01-23