Incidental Mutation 'R8032:Dsc2'
ID 618054
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20165331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,751,955 (GRCm39) E60D probably benign Het
Adamts12 T C 15: 11,259,189 (GRCm39) probably null Het
Ak9 T A 10: 41,300,616 (GRCm39) C1609S unknown Het
Aox1 A T 1: 58,389,442 (GRCm39) Y1147F probably benign Het
Atf7ip T C 6: 136,542,110 (GRCm39) F615L probably benign Het
BC005624 A G 2: 30,865,901 (GRCm39) probably null Het
BC024063 T A 10: 81,943,738 (GRCm39) M33K probably benign Het
Bmpr2 T A 1: 59,906,502 (GRCm39) S532T probably benign Het
Cast G A 13: 74,883,360 (GRCm39) Q292* probably null Het
Ccdc7a G T 8: 129,551,864 (GRCm39) H1249N unknown Het
Cd177 C T 7: 24,455,594 (GRCm39) W309* probably null Het
Col15a1 T C 4: 47,288,108 (GRCm39) I4T unknown Het
Cyp2c39 A G 19: 39,499,426 (GRCm39) I38V probably benign Het
Dmpk A G 7: 18,821,978 (GRCm39) D312G possibly damaging Het
Dnah1 T C 14: 30,993,505 (GRCm39) D2892G probably damaging Het
Dnah10 G A 5: 124,823,676 (GRCm39) D566N probably damaging Het
Exd2 T A 12: 80,536,427 (GRCm39) D352E probably benign Het
Fgf8 A T 19: 45,725,676 (GRCm39) L187Q probably damaging Het
Frrs1 A G 3: 116,672,009 (GRCm39) I36V probably benign Het
Gga2 A T 7: 121,620,210 (GRCm39) probably null Het
Gigyf2 C G 1: 87,334,735 (GRCm39) H249D unknown Het
Gli2 A T 1: 118,763,900 (GRCm39) M1417K probably damaging Het
Gm10801 C CGTA 2: 98,494,152 (GRCm39) probably null Het
Gm49380 A T 9: 44,023,000 (GRCm39) I416N probably damaging Het
Gpr137 T C 19: 6,919,480 (GRCm39) T16A unknown Het
Grid1 T A 14: 35,045,316 (GRCm39) D386E probably benign Het
Grm3 A G 5: 9,562,272 (GRCm39) V526A probably benign Het
Havcr2 A T 11: 46,370,118 (GRCm39) I231F probably damaging Het
Icam5 C A 9: 20,944,514 (GRCm39) R72S probably benign Het
Ighv9-2 T A 12: 114,072,764 (GRCm39) I70L possibly damaging Het
Inpp5e C T 2: 26,286,865 (GRCm39) S119N Het
Kash5 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 44,837,608 (GRCm39) probably benign Het
Kash5 TCAGGC TCAGGCACAGGC 7: 44,837,630 (GRCm39) probably benign Het
Kxd1 T A 8: 70,966,791 (GRCm39) D110V possibly damaging Het
Mbd4 A G 6: 115,821,594 (GRCm39) S474P probably damaging Het
Meaf6 C A 4: 124,996,795 (GRCm39) H168Q unknown Het
Nek2 T C 1: 191,558,457 (GRCm39) L254S probably damaging Het
Nhej1 T C 1: 75,007,959 (GRCm39) D104G probably benign Het
Nmnat3 A G 9: 98,292,271 (GRCm39) E172G probably benign Het
Npm3 A T 19: 45,736,682 (GRCm39) D152E probably benign Het
Nsd1 A T 13: 55,458,196 (GRCm39) K2103M probably damaging Het
Ntrk3 C T 7: 78,005,807 (GRCm39) R518H probably damaging Het
Nup210 T A 6: 91,051,331 (GRCm39) T351S probably benign Het
Or10h5 T A 17: 33,434,924 (GRCm39) R131S possibly damaging Het
Or9g19 A G 2: 85,600,210 (GRCm39) I22V probably benign Het
Otof T A 5: 30,619,142 (GRCm39) M1L probably benign Het
Pacs2 T A 12: 113,025,278 (GRCm39) Y477N probably damaging Het
Panx3 A G 9: 37,572,966 (GRCm39) Y195H probably damaging Het
Pcsk5 T C 19: 17,692,151 (GRCm39) R178G probably damaging Het
Pde7a A G 3: 19,314,429 (GRCm39) S56P possibly damaging Het
Prcp T G 7: 92,577,906 (GRCm39) C392G probably damaging Het
Prkdc A G 16: 15,597,315 (GRCm39) K2825R probably benign Het
Ptpn12 T C 5: 21,203,041 (GRCm39) H579R probably benign Het
Rbl1 A T 2: 157,029,918 (GRCm39) Y468* probably null Het
Rbmxl2 A G 7: 106,809,429 (GRCm39) Y238C probably damaging Het
Scgb2b20 A T 7: 33,065,724 (GRCm39) M1K probably null Het
Slc25a18 G A 6: 120,769,452 (GRCm39) G237D probably damaging Het
Slc9a3 G A 13: 74,305,763 (GRCm39) G260D probably damaging Het
Sorcs1 A T 19: 50,463,846 (GRCm39) S201R probably benign Het
Strip1 A C 3: 107,525,394 (GRCm39) D547E probably damaging Het
Thsd7a C T 6: 12,555,287 (GRCm39) C199Y Het
Top1mt A G 15: 75,540,572 (GRCm39) V233A probably damaging Het
Tpp2 C G 1: 44,014,628 (GRCm39) P656A possibly damaging Het
Ttc1 A T 11: 43,628,806 (GRCm39) L193Q probably damaging Het
Ttll4 T A 1: 74,735,632 (GRCm39) D1013E possibly damaging Het
Unc5a T C 13: 55,144,299 (GRCm39) V208A possibly damaging Het
Vmn1r185 C A 7: 26,310,558 (GRCm39) V316F probably benign Het
Vmn2r112 T A 17: 22,822,375 (GRCm39) V351E probably benign Het
Wdfy4 T A 14: 32,751,043 (GRCm39) K2391* probably null Het
Zfhx3 T C 8: 109,677,854 (GRCm39) V2968A possibly damaging Het
Zfp551 G A 7: 12,152,487 (GRCm39) A82V possibly damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On 2020-01-23