Incidental Mutation 'R8032:Dsc2'
ID618054
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8032 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20032274 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 881 (G881R)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably benign
Transcript: ENSMUST00000039247
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075214
AA Change: G881R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: G881R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt2 T A 4: 154,667,498 E60D probably benign Het
Adamts12 T C 15: 11,259,103 probably null Het
Ak9 T A 10: 41,424,620 C1609S unknown Het
Aox2 A T 1: 58,350,283 Y1147F probably benign Het
Atf7ip T C 6: 136,565,112 F615L probably benign Het
BC005624 A G 2: 30,975,889 probably null Het
BC024063 T A 10: 82,107,904 M33K probably benign Het
Bmpr2 T A 1: 59,867,343 S532T probably benign Het
Cast G A 13: 74,735,241 Q292* probably null Het
Ccdc155 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC 7: 45,188,184 probably benign Het
Ccdc155 TCAGGC TCAGGCACAGGC 7: 45,188,206 probably benign Het
Ccdc7a G T 8: 128,825,383 H1249N unknown Het
Cd177 C T 7: 24,756,169 W309* probably null Het
Col15a1 T C 4: 47,288,108 I4T unknown Het
Cyp2c39 A G 19: 39,510,982 I38V probably benign Het
Dmpk A G 7: 19,088,053 D312G possibly damaging Het
Dnah1 T C 14: 31,271,548 D2892G probably damaging Het
Dnah10 G A 5: 124,746,612 D566N probably damaging Het
Exd2 T A 12: 80,489,653 D352E probably benign Het
Fgf8 A T 19: 45,737,237 L187Q probably damaging Het
Frrs1 A G 3: 116,878,360 I36V probably benign Het
Gga2 A T 7: 122,020,987 probably null Het
Gigyf2 C G 1: 87,407,013 H249D unknown Het
Gli2 A T 1: 118,836,170 M1417K probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm49380 A T 9: 44,111,703 I416N probably damaging Het
Gpr137 T C 19: 6,942,112 T16A unknown Het
Grid1 T A 14: 35,323,359 D386E probably benign Het
Grm3 A G 5: 9,512,272 V526A probably benign Het
Havcr2 A T 11: 46,479,291 I231F probably damaging Het
Icam5 C A 9: 21,033,218 R72S probably benign Het
Ighv9-2 T A 12: 114,109,144 I70L possibly damaging Het
Inpp5e C T 2: 26,396,853 S119N Het
Kxd1 T A 8: 70,514,141 D110V possibly damaging Het
Mbd4 A G 6: 115,844,633 S474P probably damaging Het
Meaf6 C A 4: 125,103,002 H168Q unknown Het
Nek2 T C 1: 191,826,345 L254S probably damaging Het
Nhej1 T C 1: 74,968,800 D104G probably benign Het
Nmnat3 A G 9: 98,410,218 E172G probably benign Het
Npm3 A T 19: 45,748,243 D152E probably benign Het
Nsd1 A T 13: 55,310,383 K2103M probably damaging Het
Ntrk3 C T 7: 78,356,059 R518H probably damaging Het
Nup210 T A 6: 91,074,349 T351S probably benign Het
Olfr1013 A G 2: 85,769,866 I22V probably benign Het
Olfr1564 T A 17: 33,215,950 R131S possibly damaging Het
Otof T A 5: 30,461,798 M1L probably benign Het
Pacs2 T A 12: 113,061,658 Y477N probably damaging Het
Panx3 A G 9: 37,661,670 Y195H probably damaging Het
Pcsk5 T C 19: 17,714,787 R178G probably damaging Het
Pde7a A G 3: 19,260,265 S56P possibly damaging Het
Prcp T G 7: 92,928,698 C392G probably damaging Het
Prkdc A G 16: 15,779,451 K2825R probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rbl1 A T 2: 157,187,998 Y468* probably null Het
Rbmxl2 A G 7: 107,210,222 Y238C probably damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Slc25a18 G A 6: 120,792,491 G237D probably damaging Het
Slc9a3 G A 13: 74,157,644 G260D probably damaging Het
Sorcs1 A T 19: 50,475,408 S201R probably benign Het
Strip1 A C 3: 107,618,078 D547E probably damaging Het
Thsd7a C T 6: 12,555,288 C199Y Het
Top1mt A G 15: 75,668,723 V233A probably damaging Het
Tpp2 C G 1: 43,975,468 P656A possibly damaging Het
Ttc1 A T 11: 43,737,979 L193Q probably damaging Het
Ttll4 T A 1: 74,696,473 D1013E possibly damaging Het
Unc5a T C 13: 54,996,486 V208A possibly damaging Het
Vmn1r185 C A 7: 26,611,133 V316F probably benign Het
Vmn2r112 T A 17: 22,603,394 V351E probably benign Het
Wdfy4 T A 14: 33,029,086 K2391* probably null Het
Zfhx3 T C 8: 108,951,222 V2968A possibly damaging Het
Zfp551 G A 7: 12,418,560 A82V possibly damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCAGACCGAGATAGGAG -3'
(R):5'- AACCATTAGAGGACACACTCTG -3'

Sequencing Primer
(F):5'- CGAGATAGGAGAGGGAGCCCC -3'
(R):5'- CTTTTTCTGTTAGTACACTTTGGTGC -3'
Posted On2020-01-23