Incidental Mutation 'R8033:Upp2'
ID618068
Institutional Source Beutler Lab
Gene Symbol Upp2
Ensembl Gene ENSMUSG00000026839
Gene Nameuridine phosphorylase 2
SynonymsUDRPASE2, UP2, UPASE2, 1700124F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8033 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location58567298-58792971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58780059 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 259 (Y259C)
Ref Sequence ENSEMBL: ENSMUSP00000060437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059102] [ENSMUST00000071543] [ENSMUST00000102755] [ENSMUST00000229923] [ENSMUST00000230627]
Predicted Effect probably damaging
Transcript: ENSMUST00000059102
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060437
Gene: ENSMUSG00000026839
AA Change: Y259C

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 78 328 6.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071543
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071474
Gene: ENSMUSG00000026839
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:PNP_UDP_1 98 316 7.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102755
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099816
Gene: ENSMUSG00000026839
AA Change: Y241C

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 60 310 4.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229923
AA Change: Y241C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230627
AA Change: Y207C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,036,522 I1335K probably damaging Het
Adgrb2 A G 4: 130,019,012 E1277G probably benign Het
Agbl3 A G 6: 34,839,494 T785A possibly damaging Het
Ahnak T C 19: 9,003,710 V786A probably benign Het
Armc2 A G 10: 42,008,684 I87T possibly damaging Het
Asap2 T C 12: 21,224,389 S373P probably damaging Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Chd2 A G 7: 73,435,880 Y1669H probably damaging Het
Clic3 A G 2: 25,458,605 E199G probably benign Het
Cpa4 G A 6: 30,590,800 V366I probably benign Het
Creg2 T C 1: 39,650,627 Y105C probably damaging Het
Cyp20a1 T C 1: 60,372,591 I266T probably benign Het
Dido1 T C 2: 180,674,842 D685G probably damaging Het
Dopey2 C G 16: 93,769,483 R1051G probably benign Het
Fam114a2 A G 11: 57,507,507 S202P probably damaging Het
Fance G T 17: 28,313,685 probably benign Het
Farsa T A 8: 84,867,569 L316Q probably benign Het
Fcrl6 T C 1: 172,599,181 D66G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gh A T 11: 106,300,555 D154E probably benign Het
Gm11487 T C 4: 73,403,092 N143D probably benign Het
Kmt2a A T 9: 44,845,470 V1160E probably damaging Het
Lct T C 1: 128,285,259 T1886A probably benign Het
Lrwd1 G A 5: 136,123,225 L633F probably damaging Het
Mmp15 A T 8: 95,367,962 N155Y probably benign Het
Mtf2 T G 5: 108,087,085 C125G probably damaging Het
Muc16 A T 9: 18,636,606 D6130E probably benign Het
Olfr1036 T A 2: 86,074,875 I45N possibly damaging Het
Orc1 T A 4: 108,605,564 Y613N probably damaging Het
Pak1 A G 7: 97,886,383 N227S probably benign Het
Pex3 G A 10: 13,531,280 Q306* probably null Het
Pld1 A T 3: 28,029,210 M160L probably benign Het
Plekhh1 G A 12: 79,070,936 R902H probably benign Het
Prp2 A G 6: 132,600,428 H226R unknown Het
Rad21 T G 15: 51,964,232 T578P probably damaging Het
Sp140 G A 1: 85,620,094 V181I probably benign Het
Spen A G 4: 141,471,746 V3190A probably benign Het
Spg11 A C 2: 122,086,951 C1011W probably damaging Het
Syngr3 G A 17: 24,686,605 R132* probably null Het
Tbc1d10c A G 19: 4,188,014 F254L possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Timm50 G A 7: 28,306,833 A281V possibly damaging Het
Tmem144 C T 3: 79,825,317 R218K probably benign Het
Vcan A G 13: 89,704,360 V827A probably benign Het
Vps41 T A 13: 18,810,465 W161R possibly damaging Het
Zfp994 A T 17: 22,200,684 I428N probably damaging Het
Other mutations in Upp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Upp2 APN 2 58790064 missense probably benign 0.43
IGL01716:Upp2 APN 2 58790046 missense probably damaging 0.99
IGL02069:Upp2 APN 2 58771417 splice site probably benign
IGL02349:Upp2 APN 2 58777886 missense probably benign 0.03
IGL03072:Upp2 APN 2 58755423 critical splice donor site probably null
R0815:Upp2 UTSW 2 58771556 missense probably benign 0.00
R1164:Upp2 UTSW 2 58763704 missense probably damaging 1.00
R1400:Upp2 UTSW 2 58790106 missense probably damaging 1.00
R1553:Upp2 UTSW 2 58790140 missense probably damaging 1.00
R1581:Upp2 UTSW 2 58774165 missense possibly damaging 0.93
R1674:Upp2 UTSW 2 58790064 missense probably benign 0.43
R1702:Upp2 UTSW 2 58771550 missense possibly damaging 0.86
R1902:Upp2 UTSW 2 58771452 missense probably damaging 1.00
R2351:Upp2 UTSW 2 58763662 splice site probably null
R3011:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R3622:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3623:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3731:Upp2 UTSW 2 58755367 missense probably benign 0.02
R4257:Upp2 UTSW 2 58780094 missense probably damaging 1.00
R4296:Upp2 UTSW 2 58778009 missense probably damaging 1.00
R4768:Upp2 UTSW 2 58777895 missense probably damaging 0.99
R5116:Upp2 UTSW 2 58771542 missense probably damaging 1.00
R5638:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R7100:Upp2 UTSW 2 58791805 missense probably benign
R7421:Upp2 UTSW 2 58771574 missense possibly damaging 0.49
R7727:Upp2 UTSW 2 58774148 missense possibly damaging 0.95
R7840:Upp2 UTSW 2 58774115 critical splice acceptor site probably null
R8359:Upp2 UTSW 2 58777943 missense probably benign 0.05
R8461:Upp2 UTSW 2 58780056 missense probably benign 0.02
R8510:Upp2 UTSW 2 58780106 missense probably damaging 1.00
Z1177:Upp2 UTSW 2 58780062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGAGGTCATGTTCTATAGTCC -3'
(R):5'- AATAAAATGTGTTGGGGCCCC -3'

Sequencing Primer
(F):5'- AGAGTCCACAGCCAGGTC -3'
(R):5'- GTTGGGGCCCCCTCCTTTC -3'
Posted On2020-01-23