Incidental Mutation 'R8033:Orc1'
ID618075
Institutional Source Beutler Lab
Gene Symbol Orc1
Ensembl Gene ENSMUSG00000028587
Gene Nameorigin recognition complex, subunit 1
SynonymsMmORC1, Orc1l
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8033 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location108579423-108614833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108605564 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 613 (Y613N)
Ref Sequence ENSEMBL: ENSMUSP00000099805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102744]
PDB Structure
Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102744
AA Change: Y613N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: Y613N

DomainStartEndE-ValueType
BAH 44 170 1.88e-31 SMART
low complexity region 394 417 N/A INTRINSIC
AAA 505 656 1e-7 SMART
Cdc6_C 757 837 5.45e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,036,522 I1335K probably damaging Het
Adgrb2 A G 4: 130,019,012 E1277G probably benign Het
Agbl3 A G 6: 34,839,494 T785A possibly damaging Het
Ahnak T C 19: 9,003,710 V786A probably benign Het
Armc2 A G 10: 42,008,684 I87T possibly damaging Het
Asap2 T C 12: 21,224,389 S373P probably damaging Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Chd2 A G 7: 73,435,880 Y1669H probably damaging Het
Clic3 A G 2: 25,458,605 E199G probably benign Het
Cpa4 G A 6: 30,590,800 V366I probably benign Het
Creg2 T C 1: 39,650,627 Y105C probably damaging Het
Cyp20a1 T C 1: 60,372,591 I266T probably benign Het
Dido1 T C 2: 180,674,842 D685G probably damaging Het
Dopey2 C G 16: 93,769,483 R1051G probably benign Het
Fam114a2 A G 11: 57,507,507 S202P probably damaging Het
Fance G T 17: 28,313,685 probably benign Het
Farsa T A 8: 84,867,569 L316Q probably benign Het
Fcrl6 T C 1: 172,599,181 D66G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gh A T 11: 106,300,555 D154E probably benign Het
Gm11487 T C 4: 73,403,092 N143D probably benign Het
Kmt2a A T 9: 44,845,470 V1160E probably damaging Het
Lct T C 1: 128,285,259 T1886A probably benign Het
Lrwd1 G A 5: 136,123,225 L633F probably damaging Het
Mmp15 A T 8: 95,367,962 N155Y probably benign Het
Mtf2 T G 5: 108,087,085 C125G probably damaging Het
Muc16 A T 9: 18,636,606 D6130E probably benign Het
Olfr1036 T A 2: 86,074,875 I45N possibly damaging Het
Pak1 A G 7: 97,886,383 N227S probably benign Het
Pex3 G A 10: 13,531,280 Q306* probably null Het
Pld1 A T 3: 28,029,210 M160L probably benign Het
Plekhh1 G A 12: 79,070,936 R902H probably benign Het
Prp2 A G 6: 132,600,428 H226R unknown Het
Rad21 T G 15: 51,964,232 T578P probably damaging Het
Sp140 G A 1: 85,620,094 V181I probably benign Het
Spen A G 4: 141,471,746 V3190A probably benign Het
Spg11 A C 2: 122,086,951 C1011W probably damaging Het
Syngr3 G A 17: 24,686,605 R132* probably null Het
Tbc1d10c A G 19: 4,188,014 F254L possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Timm50 G A 7: 28,306,833 A281V possibly damaging Het
Tmem144 C T 3: 79,825,317 R218K probably benign Het
Upp2 A G 2: 58,780,059 Y259C probably damaging Het
Vcan A G 13: 89,704,360 V827A probably benign Het
Vps41 T A 13: 18,810,465 W161R possibly damaging Het
Zfp994 A T 17: 22,200,684 I428N probably damaging Het
Other mutations in Orc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Orc1 APN 4 108595325 splice site probably benign
IGL00709:Orc1 APN 4 108590778 critical splice donor site probably null
IGL01124:Orc1 APN 4 108588787 splice site probably benign
IGL01514:Orc1 APN 4 108602052 missense probably damaging 0.97
IGL01677:Orc1 APN 4 108604585 missense probably damaging 1.00
IGL01782:Orc1 APN 4 108606268 missense possibly damaging 0.78
IGL01886:Orc1 APN 4 108603957 splice site probably null
IGL01912:Orc1 APN 4 108590744 missense probably damaging 1.00
IGL02057:Orc1 APN 4 108588729 missense possibly damaging 0.53
IGL02155:Orc1 APN 4 108590677 missense probably benign 0.00
IGL02311:Orc1 APN 4 108599974 missense probably benign
IGL02616:Orc1 APN 4 108595479 missense probably benign 0.00
land_lubber UTSW 4 108588687 start codon destroyed probably damaging 0.99
R0012:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0195:Orc1 UTSW 4 108614308 nonsense probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0611:Orc1 UTSW 4 108602032 missense probably benign
R1351:Orc1 UTSW 4 108595367 missense probably benign 0.01
R1966:Orc1 UTSW 4 108612217 missense probably damaging 1.00
R2018:Orc1 UTSW 4 108590700 missense possibly damaging 0.95
R2398:Orc1 UTSW 4 108601969 missense possibly damaging 0.68
R3110:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3112:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3712:Orc1 UTSW 4 108604021 missense probably damaging 1.00
R3716:Orc1 UTSW 4 108614459 missense probably damaging 1.00
R3829:Orc1 UTSW 4 108605631 missense probably damaging 1.00
R4282:Orc1 UTSW 4 108606274 missense probably benign 0.18
R4320:Orc1 UTSW 4 108588776 missense probably benign
R4321:Orc1 UTSW 4 108588776 missense probably benign
R4322:Orc1 UTSW 4 108588776 missense probably benign
R4348:Orc1 UTSW 4 108593452 missense probably damaging 0.98
R4562:Orc1 UTSW 4 108602055 critical splice donor site probably null
R4772:Orc1 UTSW 4 108579568 utr 5 prime probably benign
R4914:Orc1 UTSW 4 108604558 missense probably damaging 1.00
R4964:Orc1 UTSW 4 108614473 makesense probably null
R5219:Orc1 UTSW 4 108590769 missense probably damaging 1.00
R5428:Orc1 UTSW 4 108599940 missense probably benign 0.00
R5655:Orc1 UTSW 4 108593439 missense probably benign 0.09
R5693:Orc1 UTSW 4 108613079 missense probably benign 0.01
R5936:Orc1 UTSW 4 108601983 missense probably benign 0.10
R5960:Orc1 UTSW 4 108606298 missense possibly damaging 0.67
R6294:Orc1 UTSW 4 108590670 missense probably benign 0.01
R6504:Orc1 UTSW 4 108590717 missense probably benign 0.15
R6533:Orc1 UTSW 4 108597447 missense probably benign 0.05
R6775:Orc1 UTSW 4 108603455 missense probably damaging 1.00
R7123:Orc1 UTSW 4 108588687 start codon destroyed probably damaging 0.99
R7156:Orc1 UTSW 4 108595459 missense probably benign 0.00
R7327:Orc1 UTSW 4 108588714 missense probably benign 0.01
R7552:Orc1 UTSW 4 108588754 missense probably benign 0.41
R7842:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7925:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7982:Orc1 UTSW 4 108603371 intron probably null
Predicted Primers PCR Primer
(F):5'- AACTGAAGCCTGTCCATTGATTC -3'
(R):5'- AAAGGGCAAGCAACATTTCTC -3'

Sequencing Primer
(F):5'- CTCTTACGGACTAGAAAGTGCCATG -3'
(R):5'- GGGCAAGCAACATTTCTCATTCC -3'
Posted On2020-01-23