Incidental Mutation 'R8033:Lrwd1'
ID618080
Institutional Source Beutler Lab
Gene Symbol Lrwd1
Ensembl Gene ENSMUSG00000029703
Gene Nameleucine-rich repeats and WD repeat domain containing 1
Synonyms1200011O22Rik, Orca
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R8033 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location136122772-136136074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136123225 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 633 (L633F)
Ref Sequence ENSEMBL: ENSMUSP00000006301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000041366] [ENSMUST00000111127] [ENSMUST00000111129]
Predicted Effect probably damaging
Transcript: ENSMUST00000006301
AA Change: L633F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703
AA Change: L633F

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
LRR_TYP 46 69 3.16e-3 SMART
LRR 90 113 1.58e2 SMART
WD40 271 327 6.36e1 SMART
Blast:WD40 330 380 2e-12 BLAST
WD40 383 423 1.49e-7 SMART
WD40 434 473 2.28e2 SMART
Blast:WD40 484 527 6e-15 BLAST
WD40 542 583 1.42e2 SMART
low complexity region 591 602 N/A INTRINSIC
Blast:WD40 603 646 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041366
SMART Domains Protein: ENSMUSP00000038505
Gene: ENSMUSG00000039771

DomainStartEndE-ValueType
Pfam:RNA_pol_L_2 30 104 5.3e-32 PFAM
Pfam:RNA_pol_L 32 98 4.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111127
SMART Domains Protein: ENSMUSP00000106757
Gene: ENSMUSG00000039771

DomainStartEndE-ValueType
Pfam:RNA_pol_L_2 29 105 3.6e-33 PFAM
Pfam:RNA_pol_L 31 99 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111129
SMART Domains Protein: ENSMUSP00000106759
Gene: ENSMUSG00000039771

DomainStartEndE-ValueType
Pfam:RNA_pol_L 17 69 2.7e-9 PFAM
Pfam:RNA_pol_L_2 17 75 1.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128255
SMART Domains Protein: ENSMUSP00000119546
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
Blast:WD40 13 66 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with components of the origin recognition complex (ORC) and regulates the formation of the prereplicative complex. The encoded protein stabilizes the ORC and therefore aids in DNA replication. This protein is required for the G1/S phase transition of the cell cycle. In addition, the encoded protein binds to trimethylated histone H3 in heterochromatin and recruits the ORC and lysine methyltransferases, which help maintain the repressive heterochromatic state. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,036,522 I1335K probably damaging Het
Adgrb2 A G 4: 130,019,012 E1277G probably benign Het
Agbl3 A G 6: 34,839,494 T785A possibly damaging Het
Ahnak T C 19: 9,003,710 V786A probably benign Het
Armc2 A G 10: 42,008,684 I87T possibly damaging Het
Asap2 T C 12: 21,224,389 S373P probably damaging Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Chd2 A G 7: 73,435,880 Y1669H probably damaging Het
Clic3 A G 2: 25,458,605 E199G probably benign Het
Cpa4 G A 6: 30,590,800 V366I probably benign Het
Creg2 T C 1: 39,650,627 Y105C probably damaging Het
Cyp20a1 T C 1: 60,372,591 I266T probably benign Het
Dido1 T C 2: 180,674,842 D685G probably damaging Het
Dopey2 C G 16: 93,769,483 R1051G probably benign Het
Fam114a2 A G 11: 57,507,507 S202P probably damaging Het
Fance G T 17: 28,313,685 probably benign Het
Farsa T A 8: 84,867,569 L316Q probably benign Het
Fcrl6 T C 1: 172,599,181 D66G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gh A T 11: 106,300,555 D154E probably benign Het
Gm11487 T C 4: 73,403,092 N143D probably benign Het
Kmt2a A T 9: 44,845,470 V1160E probably damaging Het
Lct T C 1: 128,285,259 T1886A probably benign Het
Mmp15 A T 8: 95,367,962 N155Y probably benign Het
Mtf2 T G 5: 108,087,085 C125G probably damaging Het
Muc16 A T 9: 18,636,606 D6130E probably benign Het
Olfr1036 T A 2: 86,074,875 I45N possibly damaging Het
Orc1 T A 4: 108,605,564 Y613N probably damaging Het
Pak1 A G 7: 97,886,383 N227S probably benign Het
Pex3 G A 10: 13,531,280 Q306* probably null Het
Pld1 A T 3: 28,029,210 M160L probably benign Het
Plekhh1 G A 12: 79,070,936 R902H probably benign Het
Prp2 A G 6: 132,600,428 H226R unknown Het
Rad21 T G 15: 51,964,232 T578P probably damaging Het
Sp140 G A 1: 85,620,094 V181I probably benign Het
Spen A G 4: 141,471,746 V3190A probably benign Het
Spg11 A C 2: 122,086,951 C1011W probably damaging Het
Syngr3 G A 17: 24,686,605 R132* probably null Het
Tbc1d10c A G 19: 4,188,014 F254L possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Timm50 G A 7: 28,306,833 A281V possibly damaging Het
Tmem144 C T 3: 79,825,317 R218K probably benign Het
Upp2 A G 2: 58,780,059 Y259C probably damaging Het
Vcan A G 13: 89,704,360 V827A probably benign Het
Vps41 T A 13: 18,810,465 W161R possibly damaging Het
Zfp994 A T 17: 22,200,684 I428N probably damaging Het
Other mutations in Lrwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Lrwd1 APN 5 136134629 missense probably damaging 1.00
IGL01827:Lrwd1 APN 5 136131518 nonsense probably null
IGL01919:Lrwd1 APN 5 136135875 nonsense probably null
IGL02327:Lrwd1 APN 5 136123464 missense probably damaging 1.00
R0614:Lrwd1 UTSW 5 136123500 missense probably damaging 0.99
R0882:Lrwd1 UTSW 5 136123400 splice site probably null
R1137:Lrwd1 UTSW 5 136133419 missense probably benign 0.01
R1164:Lrwd1 UTSW 5 136130990 missense probably benign 0.00
R1302:Lrwd1 UTSW 5 136132413 missense probably benign 0.05
R1838:Lrwd1 UTSW 5 136132388 missense probably benign 0.00
R2114:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2116:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2117:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R4514:Lrwd1 UTSW 5 136131548 missense probably benign 0.00
R4595:Lrwd1 UTSW 5 136123956 missense probably benign
R5304:Lrwd1 UTSW 5 136131150 missense possibly damaging 0.49
R5384:Lrwd1 UTSW 5 136123874 missense possibly damaging 0.84
R5719:Lrwd1 UTSW 5 136132239 splice site probably null
R5771:Lrwd1 UTSW 5 136123662 missense possibly damaging 0.95
R5791:Lrwd1 UTSW 5 136131033 missense probably benign 0.44
R6431:Lrwd1 UTSW 5 136133034 missense possibly damaging 0.90
R7074:Lrwd1 UTSW 5 136123657 missense probably benign 0.01
R7132:Lrwd1 UTSW 5 136123275 missense possibly damaging 0.71
R7838:Lrwd1 UTSW 5 136132129 missense probably damaging 1.00
R7873:Lrwd1 UTSW 5 136123938 missense probably benign 0.00
Z1176:Lrwd1 UTSW 5 136134008 missense probably damaging 1.00
Z1177:Lrwd1 UTSW 5 136131541 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTGCCTGAGTTAACCAAGGTAG -3'
(R):5'- TGTTGGCACCCTACAGATCC -3'

Sequencing Primer
(F):5'- CAGTGGAGCCTGTGTGACTAC -3'
(R):5'- ACAGATCCTGGTATCCCTTAGGG -3'
Posted On2020-01-23