Incidental Mutation 'R8033:Agbl3'
ID 618083
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene Name ATP/GTP binding protein-like 3
Synonyms 4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8033 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34780432-34859459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34839494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 785 (T785A)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]
AlphaFold Q8CDP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000115016
AA Change: T785A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: T785A

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115017
AA Change: T780A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: T780A

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,036,522 I1335K probably damaging Het
Adgrb2 A G 4: 130,019,012 E1277G probably benign Het
Ahnak T C 19: 9,003,710 V786A probably benign Het
Armc2 A G 10: 42,008,684 I87T possibly damaging Het
Asap2 T C 12: 21,224,389 S373P probably damaging Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Chd2 A G 7: 73,435,880 Y1669H probably damaging Het
Clic3 A G 2: 25,458,605 E199G probably benign Het
Cpa4 G A 6: 30,590,800 V366I probably benign Het
Creg2 T C 1: 39,650,627 Y105C probably damaging Het
Cyp20a1 T C 1: 60,372,591 I266T probably benign Het
Dido1 T C 2: 180,674,842 D685G probably damaging Het
Dopey2 C G 16: 93,769,483 R1051G probably benign Het
Fam114a2 A G 11: 57,507,507 S202P probably damaging Het
Fance G T 17: 28,313,685 probably benign Het
Farsa T A 8: 84,867,569 L316Q probably benign Het
Fcrl6 T C 1: 172,599,181 D66G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gh A T 11: 106,300,555 D154E probably benign Het
Gm11487 T C 4: 73,403,092 N143D probably benign Het
Kmt2a A T 9: 44,845,470 V1160E probably damaging Het
Lct T C 1: 128,285,259 T1886A probably benign Het
Lrwd1 G A 5: 136,123,225 L633F probably damaging Het
Mmp15 A T 8: 95,367,962 N155Y probably benign Het
Mtf2 T G 5: 108,087,085 C125G probably damaging Het
Muc16 A T 9: 18,636,606 D6130E probably benign Het
Olfr1036 T A 2: 86,074,875 I45N possibly damaging Het
Orc1 T A 4: 108,605,564 Y613N probably damaging Het
Pak1 A G 7: 97,886,383 N227S probably benign Het
Pex3 G A 10: 13,531,280 Q306* probably null Het
Pld1 A T 3: 28,029,210 M160L probably benign Het
Plekhh1 G A 12: 79,070,936 R902H probably benign Het
Prp2 A G 6: 132,600,428 H226R unknown Het
Rad21 T G 15: 51,964,232 T578P probably damaging Het
Sp140 G A 1: 85,620,094 V181I probably benign Het
Spen A G 4: 141,471,746 V3190A probably benign Het
Spg11 A C 2: 122,086,951 C1011W probably damaging Het
Syngr3 G A 17: 24,686,605 R132* probably null Het
Tbc1d10c A G 19: 4,188,014 F254L possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Timm50 G A 7: 28,306,833 A281V possibly damaging Het
Tmem144 C T 3: 79,825,317 R218K probably benign Het
Upp2 A G 2: 58,780,059 Y259C probably damaging Het
Vcan A G 13: 89,704,360 V827A probably benign Het
Vps41 T A 13: 18,810,465 W161R possibly damaging Het
Zfp994 A T 17: 22,200,684 I428N probably damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
R8203:Agbl3 UTSW 6 34799479 missense probably damaging 1.00
R8769:Agbl3 UTSW 6 34857614 missense probably damaging 0.96
R9072:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9073:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9210:Agbl3 UTSW 6 34798242 missense probably damaging 0.98
R9255:Agbl3 UTSW 6 34812905 missense probably damaging 1.00
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34799408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGCGTATGATTAAGAGTC -3'
(R):5'- AAAGTTCCTTGGCTGTAGAGTAG -3'

Sequencing Primer
(F):5'- CCCAGCGTATGATTAAGAGTCTTAAC -3'
(R):5'- ATGTGTTTCAGTCATTCAGAGATG -3'
Posted On 2020-01-23