Incidental Mutation 'R8033:Plekhh1'
ID 618098
Institutional Source Beutler Lab
Gene Symbol Plekhh1
Ensembl Gene ENSMUSG00000060716
Gene Name pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8033 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 79029163-79081655 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79070936 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 902 (R902H)
Ref Sequence ENSEMBL: ENSMUSP00000049460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039928] [ENSMUST00000219956]
AlphaFold Q80TI1
Predicted Effect probably benign
Transcript: ENSMUST00000039928
AA Change: R902H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049460
Gene: ENSMUSG00000060716
AA Change: R902H

DomainStartEndE-ValueType
coiled coil region 26 172 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
PH 573 668 1.15e-22 SMART
PH 682 792 3.23e-8 SMART
MyTH4 826 980 3e-48 SMART
B41 987 1224 6.07e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219956
AA Change: R902H

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,036,522 I1335K probably damaging Het
Adgrb2 A G 4: 130,019,012 E1277G probably benign Het
Agbl3 A G 6: 34,839,494 T785A possibly damaging Het
Ahnak T C 19: 9,003,710 V786A probably benign Het
Armc2 A G 10: 42,008,684 I87T possibly damaging Het
Asap2 T C 12: 21,224,389 S373P probably damaging Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Chd2 A G 7: 73,435,880 Y1669H probably damaging Het
Clic3 A G 2: 25,458,605 E199G probably benign Het
Cpa4 G A 6: 30,590,800 V366I probably benign Het
Creg2 T C 1: 39,650,627 Y105C probably damaging Het
Cyp20a1 T C 1: 60,372,591 I266T probably benign Het
Dido1 T C 2: 180,674,842 D685G probably damaging Het
Dopey2 C G 16: 93,769,483 R1051G probably benign Het
Fam114a2 A G 11: 57,507,507 S202P probably damaging Het
Fance G T 17: 28,313,685 probably benign Het
Farsa T A 8: 84,867,569 L316Q probably benign Het
Fcrl6 T C 1: 172,599,181 D66G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gh A T 11: 106,300,555 D154E probably benign Het
Gm11487 T C 4: 73,403,092 N143D probably benign Het
Kmt2a A T 9: 44,845,470 V1160E probably damaging Het
Lct T C 1: 128,285,259 T1886A probably benign Het
Lrwd1 G A 5: 136,123,225 L633F probably damaging Het
Mmp15 A T 8: 95,367,962 N155Y probably benign Het
Mtf2 T G 5: 108,087,085 C125G probably damaging Het
Muc16 A T 9: 18,636,606 D6130E probably benign Het
Olfr1036 T A 2: 86,074,875 I45N possibly damaging Het
Orc1 T A 4: 108,605,564 Y613N probably damaging Het
Pak1 A G 7: 97,886,383 N227S probably benign Het
Pex3 G A 10: 13,531,280 Q306* probably null Het
Pld1 A T 3: 28,029,210 M160L probably benign Het
Prp2 A G 6: 132,600,428 H226R unknown Het
Rad21 T G 15: 51,964,232 T578P probably damaging Het
Sp140 G A 1: 85,620,094 V181I probably benign Het
Spen A G 4: 141,471,746 V3190A probably benign Het
Spg11 A C 2: 122,086,951 C1011W probably damaging Het
Syngr3 G A 17: 24,686,605 R132* probably null Het
Tbc1d10c A G 19: 4,188,014 F254L possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Timm50 G A 7: 28,306,833 A281V possibly damaging Het
Tmem144 C T 3: 79,825,317 R218K probably benign Het
Upp2 A G 2: 58,780,059 Y259C probably damaging Het
Vcan A G 13: 89,704,360 V827A probably benign Het
Vps41 T A 13: 18,810,465 W161R possibly damaging Het
Zfp994 A T 17: 22,200,684 I428N probably damaging Het
Other mutations in Plekhh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Plekhh1 APN 12 79078964 missense probably benign 0.35
IGL01764:Plekhh1 APN 12 79054905 missense probably benign 0.00
IGL01922:Plekhh1 APN 12 79079579 missense probably benign
IGL02187:Plekhh1 APN 12 79072818 missense probably damaging 1.00
IGL02406:Plekhh1 APN 12 79069009 splice site probably benign
IGL02581:Plekhh1 APN 12 79079108 critical splice donor site probably null
IGL03201:Plekhh1 APN 12 79053656 missense probably damaging 1.00
R0088:Plekhh1 UTSW 12 79055366 missense probably benign 0.00
R0626:Plekhh1 UTSW 12 79040585 nonsense probably null
R0662:Plekhh1 UTSW 12 79078993 missense probably benign 0.09
R0666:Plekhh1 UTSW 12 79069115 missense probably damaging 0.99
R0966:Plekhh1 UTSW 12 79065730 missense probably damaging 1.00
R1027:Plekhh1 UTSW 12 79054482 splice site probably benign
R1507:Plekhh1 UTSW 12 79079450 missense probably damaging 1.00
R1562:Plekhh1 UTSW 12 79076708 missense probably benign 0.00
R1759:Plekhh1 UTSW 12 79072761 missense probably damaging 1.00
R1839:Plekhh1 UTSW 12 79078957 splice site probably benign
R2125:Plekhh1 UTSW 12 79079000 missense probably damaging 1.00
R2345:Plekhh1 UTSW 12 79053647 missense probably damaging 1.00
R3895:Plekhh1 UTSW 12 79055232 missense probably benign
R3927:Plekhh1 UTSW 12 79053648 missense probably damaging 1.00
R4039:Plekhh1 UTSW 12 79055183 missense probably benign 0.01
R4720:Plekhh1 UTSW 12 79075420 frame shift probably null
R4721:Plekhh1 UTSW 12 79075420 frame shift probably null
R4824:Plekhh1 UTSW 12 79054803 missense probably benign
R4869:Plekhh1 UTSW 12 79050386 missense probably benign
R5114:Plekhh1 UTSW 12 79069106 missense probably benign 0.00
R5809:Plekhh1 UTSW 12 79078687 missense probably benign 0.26
R6540:Plekhh1 UTSW 12 79064489 missense probably benign 0.14
R6977:Plekhh1 UTSW 12 79065717 missense probably damaging 1.00
R7058:Plekhh1 UTSW 12 79075430 missense probably damaging 1.00
R7103:Plekhh1 UTSW 12 79066655 missense probably benign 0.01
R7120:Plekhh1 UTSW 12 79070939 missense probably benign 0.03
R7134:Plekhh1 UTSW 12 79062616 missense probably benign 0.00
R7209:Plekhh1 UTSW 12 79050376 missense probably benign 0.04
R7403:Plekhh1 UTSW 12 79040577 nonsense probably null
R7405:Plekhh1 UTSW 12 79055047 missense probably benign 0.00
R7449:Plekhh1 UTSW 12 79079552 missense probably benign 0.00
R7594:Plekhh1 UTSW 12 79076503 missense possibly damaging 0.89
R7648:Plekhh1 UTSW 12 79055131 missense probably benign 0.20
R7756:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R7758:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R8153:Plekhh1 UTSW 12 79079038 missense probably benign 0.00
R8243:Plekhh1 UTSW 12 79079069 missense probably benign
R8728:Plekhh1 UTSW 12 79069088 missense possibly damaging 0.90
R8992:Plekhh1 UTSW 12 79075533 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTTTCTTGAGGCGCTGC -3'
(R):5'- CAGTGGGTGAGCATGCACATATC -3'

Sequencing Primer
(F):5'- GTGCAGGTCACAAGAATAACC -3'
(R):5'- TGCACATATCAAACAGCTTGGAG -3'
Posted On 2020-01-23