Incidental Mutation 'R8034:Sp140l2'
ID 618109
Institutional Source Beutler Lab
Gene Symbol Sp140l2
Ensembl Gene ENSMUSG00000052477
Gene Name Sp140 nuclear body protein like 2
Synonyms OTTMUSG00000029174, C130026I21Rik
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.415) question?
Stock # R8034 (G1)
Quality Score 195.009
Status Not validated
Chromosome 1
Chromosomal Location 85219007-85260602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85231881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 180 (T180S)
Ref Sequence ENSEMBL: ENSMUSP00000091224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064341] [ENSMUST00000093506] [ENSMUST00000159582] [ENSMUST00000161267] [ENSMUST00000162421]
AlphaFold Q8C898
Predicted Effect possibly damaging
Transcript: ENSMUST00000064341
AA Change: T152S

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066587
Gene: ENSMUSG00000052477
AA Change: T152S

DomainStartEndE-ValueType
Pfam:Sp100 23 125 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093506
AA Change: T180S

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091224
Gene: ENSMUSG00000052477
AA Change: T180S

DomainStartEndE-ValueType
Pfam:Sp100 24 122 1.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159582
AA Change: T152S

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125160
Gene: ENSMUSG00000052477
AA Change: T152S

DomainStartEndE-ValueType
Pfam:Sp100 23 125 6.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161267
SMART Domains Protein: ENSMUSP00000124435
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 23 119 1.8e-37 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162421
SMART Domains Protein: ENSMUSP00000125215
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 40 135 2.2e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
H2-Q10 A T 17: 35,781,338 (GRCm39) I47F probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lcn6 T A 2: 25,566,883 (GRCm39) L19* probably null Het
Lhcgr T C 17: 89,049,784 (GRCm39) T581A probably damaging Het
Map4k1 T C 7: 28,687,573 (GRCm39) I203T probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Npas3 T A 12: 53,687,312 (GRCm39) I159N probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sec13 T C 6: 113,712,050 (GRCm39) K95R probably benign Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sema5a A G 15: 32,574,987 (GRCm39) Y365C probably damaging Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in Sp140l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01876:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01880:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01883:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01886:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01888:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01893:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01898:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01906:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01908:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01909:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01916:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01918:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01920:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01923:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01928:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01933:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01945:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01949:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01951:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
IGL01952:Sp140l2 APN 1 85,231,907 (GRCm39) intron probably benign
PIT4131001:Sp140l2 UTSW 1 85,223,395 (GRCm39) intron probably benign
PIT4142001:Sp140l2 UTSW 1 85,223,395 (GRCm39) intron probably benign
R0067:Sp140l2 UTSW 1 85,247,773 (GRCm39) missense probably benign 0.00
R0367:Sp140l2 UTSW 1 85,247,824 (GRCm39) start gained probably benign
R0389:Sp140l2 UTSW 1 85,247,773 (GRCm39) missense probably benign 0.00
R1284:Sp140l2 UTSW 1 85,247,776 (GRCm39) missense probably damaging 0.98
R1620:Sp140l2 UTSW 1 85,231,907 (GRCm39) intron probably benign
R1622:Sp140l2 UTSW 1 85,231,907 (GRCm39) intron probably benign
R1671:Sp140l2 UTSW 1 85,235,106 (GRCm39) critical splice donor site probably null
R3115:Sp140l2 UTSW 1 85,235,106 (GRCm39) intron probably benign
R4120:Sp140l2 UTSW 1 85,237,542 (GRCm39) missense possibly damaging 0.82
R4223:Sp140l2 UTSW 1 85,090,278 (GRCm39) missense probably damaging 0.98
R4947:Sp140l2 UTSW 1 85,090,203 (GRCm39) missense probably damaging 1.00
R4996:Sp140l2 UTSW 1 85,224,815 (GRCm39) missense probably benign 0.12
R5152:Sp140l2 UTSW 1 85,239,581 (GRCm39) missense probably benign 0.04
R6614:Sp140l2 UTSW 1 85,179,781 (GRCm39) splice site probably null
R7675:Sp140l2 UTSW 1 85,224,736 (GRCm39) missense probably benign
R7784:Sp140l2 UTSW 1 85,190,195 (GRCm39) splice site probably null
R7839:Sp140l2 UTSW 1 85,224,736 (GRCm39) missense probably benign
R8010:Sp140l2 UTSW 1 85,224,671 (GRCm39) missense possibly damaging 0.53
R8382:Sp140l2 UTSW 1 85,224,671 (GRCm39) missense possibly damaging 0.53
R8431:Sp140l2 UTSW 1 85,235,170 (GRCm39) missense probably benign 0.00
R8690:Sp140l2 UTSW 1 85,235,170 (GRCm39) missense probably benign 0.00
R8951:Sp140l2 UTSW 1 85,224,671 (GRCm39) missense possibly damaging 0.53
R9150:Sp140l2 UTSW 1 85,091,359 (GRCm39) missense probably damaging 0.96
Z1176:Sp140l2 UTSW 1 85,091,244 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGACCGTCTCTTCATGGTG -3'
(R):5'- TCAGGCGAAGTCATAGAGGC -3'

Sequencing Primer
(F):5'- CTTCATGGTGATGTGCATACAGAGC -3'
(R):5'- TCAATCCTTTGGTGACAGAGAAG -3'
Posted On 2020-01-23