Incidental Mutation 'R8034:C130026I21Rik'
ID 618109
Institutional Source Beutler Lab
Gene Symbol C130026I21Rik
Ensembl Gene ENSMUSG00000052477
Gene Name RIKEN cDNA C130026I21 gene
Synonyms OTTMUSG00000029174
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R8034 (G1)
Quality Score 195.009
Status Not validated
Chromosome 1
Chromosomal Location 84992690-85270566 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85254160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 180 (T180S)
Ref Sequence ENSEMBL: ENSMUSP00000091224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064341] [ENSMUST00000093506] [ENSMUST00000159582] [ENSMUST00000161267] [ENSMUST00000162421]
AlphaFold Q8C898
Predicted Effect possibly damaging
Transcript: ENSMUST00000064341
AA Change: T152S

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066587
Gene: ENSMUSG00000052477
AA Change: T152S

DomainStartEndE-ValueType
Pfam:Sp100 23 125 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093506
AA Change: T180S

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091224
Gene: ENSMUSG00000052477
AA Change: T180S

DomainStartEndE-ValueType
Pfam:Sp100 24 122 1.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159582
AA Change: T152S

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125160
Gene: ENSMUSG00000052477
AA Change: T152S

DomainStartEndE-ValueType
Pfam:Sp100 23 125 6.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161267
SMART Domains Protein: ENSMUSP00000124435
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 23 119 1.8e-37 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162421
SMART Domains Protein: ENSMUSP00000125215
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 40 135 2.2e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in C130026I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:C130026I21Rik APN 1 85254186 intron probably benign
IGL01876:C130026I21Rik APN 1 85254186 intron probably benign
IGL01880:C130026I21Rik APN 1 85254186 intron probably benign
IGL01883:C130026I21Rik APN 1 85254186 intron probably benign
IGL01886:C130026I21Rik APN 1 85254186 intron probably benign
IGL01888:C130026I21Rik APN 1 85254186 intron probably benign
IGL01893:C130026I21Rik APN 1 85254186 intron probably benign
IGL01898:C130026I21Rik APN 1 85254186 intron probably benign
IGL01906:C130026I21Rik APN 1 85254186 intron probably benign
IGL01908:C130026I21Rik APN 1 85254186 intron probably benign
IGL01909:C130026I21Rik APN 1 85254186 intron probably benign
IGL01916:C130026I21Rik APN 1 85254186 intron probably benign
IGL01918:C130026I21Rik APN 1 85254186 intron probably benign
IGL01920:C130026I21Rik APN 1 85254186 intron probably benign
IGL01923:C130026I21Rik APN 1 85254186 intron probably benign
IGL01928:C130026I21Rik APN 1 85254186 intron probably benign
IGL01933:C130026I21Rik APN 1 85254186 intron probably benign
IGL01945:C130026I21Rik APN 1 85254186 intron probably benign
IGL01949:C130026I21Rik APN 1 85254186 intron probably benign
IGL01951:C130026I21Rik APN 1 85254186 intron probably benign
IGL01952:C130026I21Rik APN 1 85254186 intron probably benign
PIT4131001:C130026I21Rik UTSW 1 85245674 intron probably benign
PIT4142001:C130026I21Rik UTSW 1 85245674 intron probably benign
R0067:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R0367:C130026I21Rik UTSW 1 85270103 start gained probably benign
R0389:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R1284:C130026I21Rik UTSW 1 85270055 missense probably damaging 0.98
R1620:C130026I21Rik UTSW 1 85254186 intron probably benign
R1622:C130026I21Rik UTSW 1 85254186 intron probably benign
R1671:C130026I21Rik UTSW 1 85257385 critical splice donor site probably null
R3115:C130026I21Rik UTSW 1 85257385 intron probably benign
R4120:C130026I21Rik UTSW 1 85259821 missense possibly damaging 0.82
R4223:C130026I21Rik UTSW 1 85112557 missense probably damaging 0.98
R4947:C130026I21Rik UTSW 1 85112482 missense probably damaging 1.00
R4996:C130026I21Rik UTSW 1 85247094 missense probably benign 0.12
R5152:C130026I21Rik UTSW 1 85261860 missense probably benign 0.04
R6614:C130026I21Rik UTSW 1 85202060 splice site probably null
R7675:C130026I21Rik UTSW 1 85247015 missense probably benign
R7784:C130026I21Rik UTSW 1 85212474 splice site probably null
R7839:C130026I21Rik UTSW 1 85247015 missense probably benign
R8010:C130026I21Rik UTSW 1 85246950 missense possibly damaging 0.53
R8382:C130026I21Rik UTSW 1 85246950 missense possibly damaging 0.53
R8431:C130026I21Rik UTSW 1 85257449 missense probably benign 0.00
R8690:C130026I21Rik UTSW 1 85257449 missense probably benign 0.00
R8951:C130026I21Rik UTSW 1 85246950 missense possibly damaging 0.53
R9150:C130026I21Rik UTSW 1 85113638 missense probably damaging 0.96
Z1176:C130026I21Rik UTSW 1 85113523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGACCGTCTCTTCATGGTG -3'
(R):5'- TCAGGCGAAGTCATAGAGGC -3'

Sequencing Primer
(F):5'- CTTCATGGTGATGTGCATACAGAGC -3'
(R):5'- TCAATCCTTTGGTGACAGAGAAG -3'
Posted On 2020-01-23