Incidental Mutation 'R8034:Gm7145'
ID618110
Institutional Source Beutler Lab
Gene Symbol Gm7145
Ensembl Gene ENSMUSG00000100617
Gene Namepredicted gene 7145
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location117965939-117986884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117986164 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 259 (T259S)
Ref Sequence ENSEMBL: ENSMUSP00000140916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000185381]
Predicted Effect probably benign
Transcript: ENSMUST00000185381
AA Change: T259S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140916
Gene: ENSMUSG00000100617
AA Change: T259S

DomainStartEndE-ValueType
KRAB 8 68 4.4e-36 SMART
ZnF_C2H2 109 131 3.6e-6 SMART
ZnF_C2H2 137 159 3.4e-5 SMART
ZnF_C2H2 165 187 1.7e-6 SMART
ZnF_C2H2 193 215 1e-7 SMART
ZnF_C2H2 221 243 2e-5 SMART
ZnF_C2H2 249 271 2.1e-7 SMART
ZnF_C2H2 277 299 9.3e-5 SMART
ZnF_C2H2 305 327 3.4e-4 SMART
ZnF_C2H2 333 355 3.2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Gm7145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Gm7145 APN 1 117967687 missense probably benign 0.00
R6133:Gm7145 UTSW 1 117985888 missense probably damaging 1.00
R6244:Gm7145 UTSW 1 117986140 missense probably damaging 1.00
R6381:Gm7145 UTSW 1 117985939 nonsense probably null
R6578:Gm7145 UTSW 1 117985795 missense probably damaging 0.98
R6853:Gm7145 UTSW 1 117986144 missense possibly damaging 0.95
R6913:Gm7145 UTSW 1 117985981 missense probably damaging 1.00
R7159:Gm7145 UTSW 1 117985831 missense probably benign 0.01
R7196:Gm7145 UTSW 1 117986061 missense possibly damaging 0.81
R7313:Gm7145 UTSW 1 117986202 missense probably damaging 1.00
R7343:Gm7145 UTSW 1 117986112 missense probably damaging 1.00
R7369:Gm7145 UTSW 1 117986108 missense probably benign 0.01
Z1176:Gm7145 UTSW 1 117986351 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGGAAGCTCCAGATACTCTTC -3'
(R):5'- CTGTGGTGAATTTTAGCACTTGAC -3'

Sequencing Primer
(F):5'- TTCACCACAGATTGCATACTGG -3'
(R):5'- GGTGAATTTTAGCACTTGACAAATG -3'
Posted On2020-01-23