Mutagenetix > Incidental Mutations

Incidental Mutation 'R8034:Ints7'

618112

Institutional Source

Beutler Lab

Gene Symbol

Ints7

Ensembl Gene

ENSMUSG00000037461

Gene Name

integrator complex subunit 7

Synonyms

5930412E23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R8034 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

191575636-191623688 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GATCG to GATCGTATCG at 191613071 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000194785] [ENSMUST00000194877]

Predicted Effect

probably null
Transcript: ENSMUST00000045450

SMART Domains

Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	76	530	1e-10	SMART
low complexity region	937	960	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193569

Predicted Effect

probably benign
Transcript: ENSMUST00000194785

Predicted Effect

probably benign
Transcript: ENSMUST00000194877

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Ints7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ints7	APN	1	191596164	splice site	probably null
IGL01285:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01289:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01572:Ints7	APN	1	191615793	missense	possibly damaging	0.71
IGL01665:Ints7	APN	1	191613219	splice site	probably benign
IGL02059:Ints7	APN	1	191615760	missense	probably benign	0.23
IGL02684:Ints7	APN	1	191613637	critical splice acceptor site	probably null
IGL02686:Ints7	APN	1	191586592	missense	probably damaging	1.00
IGL02812:Ints7	APN	1	191619741	missense	probably damaging	1.00
IGL03119:Ints7	APN	1	191610365	missense	probably damaging	1.00
IGL03162:Ints7	APN	1	191621412	utr 3 prime	probably benign
PIT4810001:Ints7	UTSW	1	191596236	missense	probably damaging	0.99
R0294:Ints7	UTSW	1	191611891	missense	possibly damaging	0.91
R0479:Ints7	UTSW	1	191614554	splice site	probably null
R0698:Ints7	UTSW	1	191594464	missense	probably damaging	0.97
R1420:Ints7	UTSW	1	191613057	missense	possibly damaging	0.73
R1680:Ints7	UTSW	1	191621162	splice site	probably null
R1781:Ints7	UTSW	1	191596284	missense	possibly damaging	0.95
R2141:Ints7	UTSW	1	191604860	missense	possibly damaging	0.73
R2291:Ints7	UTSW	1	191606203	splice site	probably null
R4718:Ints7	UTSW	1	191583277	missense	possibly damaging	0.60
R4741:Ints7	UTSW	1	191619635	missense	probably benign	0.29
R4797:Ints7	UTSW	1	191596933	missense	probably damaging	1.00
R4812:Ints7	UTSW	1	191594430	missense	possibly damaging	0.73
R4826:Ints7	UTSW	1	191611906	missense	probably damaging	0.97
R4870:Ints7	UTSW	1	191596331	missense	probably damaging	0.97
R5169:Ints7	UTSW	1	191613090	missense	probably benign	0.00
R5281:Ints7	UTSW	1	191615771	missense	possibly damaging	0.90
R5694:Ints7	UTSW	1	191586618	missense	probably damaging	1.00
R5752:Ints7	UTSW	1	191575893	missense	probably benign	0.00
R6048:Ints7	UTSW	1	191621412	utr 3 prime	probably benign
R6341:Ints7	UTSW	1	191613127	missense	probably damaging	1.00
R6419:Ints7	UTSW	1	191602302	missense	possibly damaging	0.69
R7037:Ints7	UTSW	1	191619605	missense	probably benign	0.16
R7163:Ints7	UTSW	1	191617837	missense	possibly damaging	0.67
R7603:Ints7	UTSW	1	191596224	missense	probably damaging	1.00
R7801:Ints7	UTSW	1	191615747	missense	possibly damaging	0.84
R7899:Ints7	UTSW	1	191621315	missense	probably damaging	1.00
R8034:Ints7	UTSW	1	191613068	frame shift	probably null
R8231:Ints7	UTSW	1	191596353	nonsense	probably null
R8251:Ints7	UTSW	1	191621433	missense	unknown
R8520:Ints7	UTSW	1	191582491	missense	probably damaging	1.00
Z1177:Ints7	UTSW	1	191610458	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCCTGTGCTCTGTGAGGAAG -3'
(R):5'- AGTGAGTACTTGACACATACCATTG -3'

Sequencing Primer
(F):5'- CCTGTGCTCTGTGAGGAAGAGATAG -3'
(R):5'- CCTTTCATCTTCAAGAATCTCTGAAG -3'

Posted On

2020-01-23