Incidental Mutation 'R8034:Lcn6'
ID 618113
Institutional Source Beutler Lab
Gene Symbol Lcn6
Ensembl Gene ENSMUSG00000045684
Gene Name lipocalin 6
Synonyms 9230101D24Rik
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 25566798-25571620 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 25566883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 19 (L19*)
Ref Sequence ENSEMBL: ENSMUSP00000109837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059693] [ENSMUST00000114197] [ENSMUST00000114199]
AlphaFold A2AJB9
Predicted Effect probably benign
Transcript: ENSMUST00000059693
SMART Domains Protein: ENSMUSP00000055660
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114197
SMART Domains Protein: ENSMUSP00000109835
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 4.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114199
AA Change: L19*
SMART Domains Protein: ENSMUSP00000109837
Gene: ENSMUSG00000045684
AA Change: L19*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lipocalin 33 172 2.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with loss of expression in the testes show premature acrosome reaction and elevated intracellular calcium levels in sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
H2-Q10 A T 17: 35,781,338 (GRCm39) I47F probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lhcgr T C 17: 89,049,784 (GRCm39) T581A probably damaging Het
Map4k1 T C 7: 28,687,573 (GRCm39) I203T probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Npas3 T A 12: 53,687,312 (GRCm39) I159N probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sec13 T C 6: 113,712,050 (GRCm39) K95R probably benign Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sema5a A G 15: 32,574,987 (GRCm39) Y365C probably damaging Het
Sp140l2 T A 1: 85,231,881 (GRCm39) T180S probably benign Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in Lcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Lcn6 APN 2 25,570,792 (GRCm39) missense probably benign 0.29
R0747:Lcn6 UTSW 2 25,567,184 (GRCm39) missense probably damaging 1.00
R1387:Lcn6 UTSW 2 25,567,149 (GRCm39) missense possibly damaging 0.86
R1500:Lcn6 UTSW 2 25,567,131 (GRCm39) missense probably benign 0.00
R1654:Lcn6 UTSW 2 25,570,787 (GRCm39) splice site probably null
R3005:Lcn6 UTSW 2 25,567,261 (GRCm39) splice site probably null
R4821:Lcn6 UTSW 2 25,570,822 (GRCm39) missense probably damaging 1.00
R4972:Lcn6 UTSW 2 25,570,079 (GRCm39) missense probably damaging 1.00
R5011:Lcn6 UTSW 2 25,567,082 (GRCm39) splice site probably null
R5013:Lcn6 UTSW 2 25,567,082 (GRCm39) splice site probably null
R7779:Lcn6 UTSW 2 25,570,805 (GRCm39) missense probably benign
R8558:Lcn6 UTSW 2 25,570,718 (GRCm39) missense probably damaging 1.00
R8697:Lcn6 UTSW 2 25,567,166 (GRCm39) missense probably benign 0.01
R9227:Lcn6 UTSW 2 25,570,107 (GRCm39) missense probably damaging 1.00
R9312:Lcn6 UTSW 2 25,570,074 (GRCm39) missense probably benign 0.23
R9740:Lcn6 UTSW 2 25,571,191 (GRCm39) missense probably benign 0.00
R9749:Lcn6 UTSW 2 25,570,034 (GRCm39) start codon destroyed probably benign
Predicted Primers PCR Primer
(F):5'- CACAGTTTAACAGCGCCCTC -3'
(R):5'- ACCTAGCTGTCCTCCCTCAAAG -3'

Sequencing Primer
(F):5'- CCACCCTGAGTAATTTGGCTTTGAG -3'
(R):5'- AAGTTCCCTCTGTCGCACAAC -3'
Posted On 2020-01-23