Incidental Mutation 'R8034:Zfp639'
ID 618117
Institutional Source Beutler Lab
Gene Symbol Zfp639
Ensembl Gene ENSMUSG00000027667
Gene Name zinc finger protein 639
Synonyms 6230400O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 32510259-32520833 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32520066 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 280 (A280E)
Ref Sequence ENSEMBL: ENSMUSP00000029203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029203] [ENSMUST00000191783] [ENSMUST00000192985] [ENSMUST00000193119] [ENSMUST00000193287]
AlphaFold Q99KZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000029203
AA Change: A280E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029203
Gene: ENSMUSG00000027667
AA Change: A280E

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191783
AA Change: A280E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141446
Gene: ENSMUSG00000027667
AA Change: A280E

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192985
Predicted Effect probably benign
Transcript: ENSMUST00000193119
Predicted Effect probably damaging
Transcript: ENSMUST00000193287
AA Change: A280E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141341
Gene: ENSMUSG00000027667
AA Change: A280E

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like zinc finger family of proteins. Amplification and overexpression of this gene have been observed in esophageal squamous cell carcinoma. The encoded protein has been shown to bind DNA in a sequence-specific manner and may regulate HIV-1 gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Other mutations in Zfp639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp639 APN 3 32519753 splice site probably null
IGL00571:Zfp639 APN 3 32519919 missense probably damaging 0.99
IGL00579:Zfp639 APN 3 32520477 missense probably damaging 0.98
IGL01952:Zfp639 APN 3 32515347 missense probably damaging 1.00
PIT4514001:Zfp639 UTSW 3 32520260 missense possibly damaging 0.46
R0412:Zfp639 UTSW 3 32517110 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R2906:Zfp639 UTSW 3 32519751 missense probably damaging 0.99
R4660:Zfp639 UTSW 3 32520530 missense probably damaging 0.99
R5109:Zfp639 UTSW 3 32520436 splice site probably null
R6012:Zfp639 UTSW 3 32519122 missense probably damaging 1.00
R6321:Zfp639 UTSW 3 32517088 missense probably damaging 1.00
R6449:Zfp639 UTSW 3 32519661 missense possibly damaging 0.92
R7020:Zfp639 UTSW 3 32520112 missense probably damaging 0.98
R9098:Zfp639 UTSW 3 32519736 missense probably damaging 0.98
R9596:Zfp639 UTSW 3 32520120 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAACATGTGATCCTGAAACAC -3'
(R):5'- ACTGCCACACTTGTCACTCAG -3'

Sequencing Primer
(F):5'- CAAGCGCACTGACTCGAATGTG -3'
(R):5'- TCAGCTCAATCAGTCTGCGAG -3'
Posted On 2020-01-23