Incidental Mutation 'R8034:Mlf1'
ID618118
Institutional Source Beutler Lab
Gene Symbol Mlf1
Ensembl Gene ENSMUSG00000048416
Gene Namemyeloid leukemia factor 1
SynonymsHLS7
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location67374097-67400003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67384588 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 29 (M29L)
Ref Sequence ENSEMBL: ENSMUSP00000058596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061322] [ENSMUST00000077916] [ENSMUST00000126628]
Predicted Effect probably damaging
Transcript: ENSMUST00000061322
AA Change: M29L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058596
Gene: ENSMUSG00000048416
AA Change: M29L

DomainStartEndE-ValueType
Pfam:Mlf1IP 26 217 7.4e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000077916
AA Change: M29L

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077072
Gene: ENSMUSG00000048416
AA Change: M29L

DomainStartEndE-ValueType
Pfam:Mlf1IP 26 203 1.5e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126628
AA Change: M29L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141208
Gene: ENSMUSG00000048416
AA Change: M29L

DomainStartEndE-ValueType
Pfam:Mlf1IP 26 69 5.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an oncoprotein which is thought to play a role in the phenotypic determination of hemopoetic cells. Translocations between this gene and nucleophosmin have been associated with myelodysplastic syndrome and acute myeloid leukemia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Mlf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Mlf1 APN 3 67399713 missense probably benign 0.20
IGL02673:Mlf1 APN 3 67393947 missense probably benign
IGL03308:Mlf1 APN 3 67397807 missense probably damaging 1.00
R1998:Mlf1 UTSW 3 67395291 missense probably damaging 1.00
R2281:Mlf1 UTSW 3 67399751 missense possibly damaging 0.95
R2566:Mlf1 UTSW 3 67384586 missense possibly damaging 0.56
R4238:Mlf1 UTSW 3 67384577 missense probably benign 0.01
R5367:Mlf1 UTSW 3 67393963 missense probably damaging 1.00
R6176:Mlf1 UTSW 3 67384594 missense probably damaging 1.00
R6326:Mlf1 UTSW 3 67399727 missense probably damaging 0.97
R6457:Mlf1 UTSW 3 67392944 missense probably benign 0.12
R7482:Mlf1 UTSW 3 67392894 missense probably benign 0.39
R7640:Mlf1 UTSW 3 67392933 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GACTTCTCAGAGTAGTCTTACCTG -3'
(R):5'- TGGAAAATGCCTCCCCTTTCATATAC -3'

Sequencing Primer
(F):5'- GAGTAGTCTTACCTGataaaaatat -3'
(R):5'- GTATGTAACTTACAACATTTGTGCC -3'
Posted On2020-01-23