Incidental Mutation 'R0660:Fmo4'
ID61812
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Nameflavin containing monooxygenase 4
Synonyms
MMRRC Submission 038845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0660 (G1)
Quality Score90
Status Validated
Chromosome1
Chromosomal Location162793188-162813972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162809848 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 25 (N25S)
Ref Sequence ENSEMBL: ENSMUSP00000107150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
Predicted Effect probably benign
Transcript: ENSMUST00000028014
AA Change: N25S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: N25S

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111525
AA Change: N25S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: N25S

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140031
Predicted Effect probably benign
Transcript: ENSMUST00000140274
AA Change: N25S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692
AA Change: N25S

DomainStartEndE-ValueType
Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144916
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 1 114 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193508
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik T C 17: 48,166,591 I53V probably benign Het
Actr3 T A 1: 125,408,567 I129L probably benign Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
Aspm T A 1: 139,457,764 M382K probably benign Het
Btbd11 G A 10: 85,388,370 A348T possibly damaging Het
Cacna1b A G 2: 24,654,446 S1243P probably damaging Het
Cenpp C T 13: 49,464,697 R244Q probably benign Het
Dock2 A G 11: 34,248,621 S1444P probably damaging Het
Ipo8 A T 6: 148,800,213 L466I probably benign Het
Olfr478 T C 7: 108,031,615 T243A probably damaging Het
Pnpla6 T C 8: 3,522,269 probably benign Het
Prkcb T C 7: 122,424,959 V69A possibly damaging Het
Sars G A 3: 108,431,473 L247F probably damaging Het
Slco1a4 T C 6: 141,812,741 I515V probably benign Het
Tanc1 A T 2: 59,843,884 K1778* probably null Het
Zkscan3 A T 13: 21,388,460 I167N probably damaging Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162794023 missense probably benign 0.00
IGL01090:Fmo4 APN 1 162809785 splice site probably null
IGL01295:Fmo4 APN 1 162799124 missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162799080 missense probably benign 0.04
IGL02483:Fmo4 APN 1 162808421 missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162803651 missense possibly damaging 0.95
R0737:Fmo4 UTSW 1 162808392 nonsense probably null
R1117:Fmo4 UTSW 1 162803663 missense probably benign 0.03
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162803700 missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162794290 missense probably benign
R1875:Fmo4 UTSW 1 162803618 missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1957:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1958:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R2011:Fmo4 UTSW 1 162798889 missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162794172 missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162809887 missense probably benign 0.20
R2272:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162794055 missense probably benign 0.39
R4255:Fmo4 UTSW 1 162794326 missense probably benign 0.00
R4273:Fmo4 UTSW 1 162805179 missense probably damaging 0.97
R4760:Fmo4 UTSW 1 162809827 missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162805273 missense probably benign 0.24
R5726:Fmo4 UTSW 1 162808259 critical splice donor site probably null
R5786:Fmo4 UTSW 1 162803717 missense probably benign 0.00
R6391:Fmo4 UTSW 1 162793969 nonsense probably null
R6826:Fmo4 UTSW 1 162803769 missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162794103 missense probably benign 0.00
R7913:Fmo4 UTSW 1 162794172 missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162798852 nonsense probably null
R8055:Fmo4 UTSW 1 162808446 missense probably benign
R8234:Fmo4 UTSW 1 162805188 missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162794223 missense probably benign 0.01
X0020:Fmo4 UTSW 1 162794378 missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162803720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGACCACCAAGGCAGGCTAATAC -3'
(R):5'- GGCGTCCTGTGGAGCTAATGTACT -3'

Sequencing Primer
(F):5'- TACCACCTCAAATGAGCAGGG -3'
(R):5'- acctttccaacacataccagtc -3'
Posted On2013-07-30