Incidental Mutation 'R8034:Ubxn2b'
ID 618122
Institutional Source Beutler Lab
Gene Symbol Ubxn2b
Ensembl Gene ENSMUSG00000028243
Gene Name UBX domain protein 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R8034 (G1)
Quality Score 220.009
Status Not validated
Chromosome 4
Chromosomal Location 6191098-6221688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6191167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 13 (E13G)
Ref Sequence ENSEMBL: ENSMUSP00000029907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029907]
AlphaFold Q0KL01
Predicted Effect probably benign
Transcript: ENSMUST00000029907
AA Change: E13G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029907
Gene: ENSMUSG00000028243
AA Change: E13G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
SEP 138 232 3.5e-39 SMART
UBX 251 330 1.05e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Ubxn2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Ubxn2b APN 4 6203767 splice site probably null
IGL02096:Ubxn2b APN 4 6214749 missense probably damaging 1.00
IGL02272:Ubxn2b APN 4 6216071 missense probably damaging 1.00
R0081:Ubxn2b UTSW 4 6203875 splice site probably benign
R0482:Ubxn2b UTSW 4 6196404 splice site probably null
R1903:Ubxn2b UTSW 4 6208889 missense possibly damaging 0.82
R4206:Ubxn2b UTSW 4 6204565 missense probably damaging 0.99
R5071:Ubxn2b UTSW 4 6214746 missense probably damaging 1.00
R7622:Ubxn2b UTSW 4 6214692 missense probably damaging 0.98
R8836:Ubxn2b UTSW 4 6216061 missense probably damaging 1.00
R9156:Ubxn2b UTSW 4 6214646 missense probably damaging 1.00
R9413:Ubxn2b UTSW 4 6204607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAATGGTGACTATAGAGAGATCTC -3'
(R):5'- TAGGGCACAGGATTCCACAC -3'

Sequencing Primer
(F):5'- CTGAAAAACTGGCGAGCCCTG -3'
(R):5'- GGATTCCACACGCACCC -3'
Posted On 2020-01-23