Incidental Mutation 'R8034:Otud3'
ID618123
Institutional Source Beutler Lab
Gene Symbol Otud3
Ensembl Gene ENSMUSG00000041161
Gene NameOTU domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location138895379-138913945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138895800 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 377 (S377G)
Ref Sequence ENSEMBL: ENSMUSP00000095441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097830]
Predicted Effect probably benign
Transcript: ENSMUST00000097830
AA Change: S377G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095441
Gene: ENSMUSG00000041161
AA Change: S377G

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
Pfam:OTU 70 185 3.6e-12 PFAM
coiled coil region 340 370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Otud3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Otud3 APN 4 138896897 missense probably benign
IGL01786:Otud3 APN 4 138896897 missense probably benign
IGL02125:Otud3 APN 4 138896714 critical splice donor site probably null
IGL03256:Otud3 APN 4 138909617 missense probably damaging 1.00
R0647:Otud3 UTSW 4 138913637 missense probably damaging 1.00
R1723:Otud3 UTSW 4 138898018 missense probably damaging 0.99
R1744:Otud3 UTSW 4 138895748 missense probably damaging 1.00
R1760:Otud3 UTSW 4 138895781 missense possibly damaging 0.51
R1954:Otud3 UTSW 4 138898032 missense possibly damaging 0.86
R3900:Otud3 UTSW 4 138896885 missense probably benign
R4890:Otud3 UTSW 4 138913749 missense probably damaging 1.00
R5534:Otud3 UTSW 4 138897583 missense probably damaging 1.00
R5769:Otud3 UTSW 4 138898110 missense possibly damaging 0.89
R5948:Otud3 UTSW 4 138897614 missense probably benign 0.00
R6235:Otud3 UTSW 4 138901901 missense probably damaging 1.00
R7121:Otud3 UTSW 4 138896756 missense probably benign 0.01
R7189:Otud3 UTSW 4 138909554 missense probably damaging 1.00
R7555:Otud3 UTSW 4 138901885 missense possibly damaging 0.77
Z1177:Otud3 UTSW 4 138896775 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AACAGCTTGAAGGACACTGG -3'
(R):5'- CCAAGTGTATTTGAACAGGAACAG -3'

Sequencing Primer
(F):5'- TTGAAGGACACTGGCTCCTG -3'
(R):5'- CAGAAGAAATTCTGGTCTCTTGGGC -3'
Posted On2020-01-23