Mutagenetix > Incidental Mutation

Incidental Mutation 'R8034:Sema3c'

618125

Institutional Source

Beutler Lab

Gene Symbol

Sema3c

Ensembl Gene

ENSMUSG00000028780

Gene Name

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C

Synonyms

1110036B02Rik, Semae

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

17574281-17730268 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17727482 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 661 (V661A)

Ref Sequence

ENSEMBL: ENSMUSP00000030568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030568]

AlphaFold

Q62181

Predicted Effect

probably damaging
Transcript: ENSMUST00000030568
AA Change: V661A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: V661A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Sema	54	495	1.16e-200	SMART
PSI	513	565	2.87e-13	SMART
IG	577	662	7.08e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Sema3c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Sema3c	APN	5	17694860	missense	probably damaging	1.00
IGL01528:Sema3c	APN	5	17714415	missense	probably benign
IGL01618:Sema3c	APN	5	17672506	missense	probably damaging	1.00
IGL01730:Sema3c	APN	5	17711436	missense	probably benign	0.01
IGL01762:Sema3c	APN	5	17694851	missense	possibly damaging	0.81
IGL02049:Sema3c	APN	5	17721925	splice site	probably benign
IGL02249:Sema3c	APN	5	17662963	missense	probably damaging	1.00
IGL02657:Sema3c	APN	5	17576868	start codon destroyed	possibly damaging	0.71
IGL02657:Sema3c	APN	5	17662974	missense	probably damaging	1.00
IGL03213:Sema3c	APN	5	17694639	splice site	probably benign
PIT4651001:Sema3c	UTSW	5	17694733	missense	probably benign	0.37
R0031:Sema3c	UTSW	5	17694728	missense	probably damaging	1.00
R0558:Sema3c	UTSW	5	17714415	missense	probably benign	0.00
R0964:Sema3c	UTSW	5	17721909	missense	probably damaging	1.00
R1164:Sema3c	UTSW	5	17678314	missense	probably benign	0.40
R1351:Sema3c	UTSW	5	17678336	missense	possibly damaging	0.60
R1368:Sema3c	UTSW	5	17678332	missense	possibly damaging	0.96
R1480:Sema3c	UTSW	5	17682031	missense	possibly damaging	0.57
R1880:Sema3c	UTSW	5	17727466	nonsense	probably null
R1916:Sema3c	UTSW	5	17727401	missense	probably benign	0.06
R3934:Sema3c	UTSW	5	17681940	missense	probably damaging	0.97
R4284:Sema3c	UTSW	5	17678347	missense	probably benign	0.01
R4449:Sema3c	UTSW	5	17576846	start gained	probably benign
R4545:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4546:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4660:Sema3c	UTSW	5	17672513	missense	probably damaging	1.00
R4890:Sema3c	UTSW	5	17675159	missense	probably benign	0.00
R4937:Sema3c	UTSW	5	17694686	missense	probably benign	0.01
R5065:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5145:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5452:Sema3c	UTSW	5	17717070	critical splice donor site	probably null
R5586:Sema3c	UTSW	5	17711424	missense	probably damaging	0.99
R5811:Sema3c	UTSW	5	17675190	splice site	probably null
R5886:Sema3c	UTSW	5	17681986	missense	possibly damaging	0.90
R6120:Sema3c	UTSW	5	17727632	missense	probably benign	0.00
R6191:Sema3c	UTSW	5	17653806	missense	probably damaging	1.00
R6318:Sema3c	UTSW	5	17672432	missense	probably damaging	0.96
R6416:Sema3c	UTSW	5	17576961	missense	probably damaging	0.99
R6441:Sema3c	UTSW	5	17724132	missense	possibly damaging	0.96
R6816:Sema3c	UTSW	5	17670465	missense	probably benign	0.36
R7146:Sema3c	UTSW	5	17694703	missense	probably benign	0.22
R7526:Sema3c	UTSW	5	17727596	missense	possibly damaging	0.46
R7832:Sema3c	UTSW	5	17694847	missense	probably damaging	0.99
R8053:Sema3c	UTSW	5	17655022	missense	probably benign	0.00
R8076:Sema3c	UTSW	5	17727364	missense	probably benign	0.00
R8264:Sema3c	UTSW	5	17676539	intron	probably benign
R8359:Sema3c	UTSW	5	17653728	missense	possibly damaging	0.56
R8437:Sema3c	UTSW	5	17662938	missense	probably damaging	0.99
R9174:Sema3c	UTSW	5	17663041	critical splice donor site	probably null
R9295:Sema3c	UTSW	5	17727497	missense	probably benign	0.09
R9477:Sema3c	UTSW	5	17716983	missense
R9599:Sema3c	UTSW	5	17714454	critical splice donor site	probably null
R9702:Sema3c	UTSW	5	17653830	missense	probably damaging	1.00
Z1176:Sema3c	UTSW	5	17727519	missense	probably benign	0.04
Z1177:Sema3c	UTSW	5	17717031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGCTGTTGCCTAGCTGTG -3'
(R):5'- GCCTTCAGCTTGCCATAGTC -3'

Sequencing Primer
(F):5'- GTTGCCTAGCTGTGAAAGTCAACC -3'
(R):5'- GTGGTTCTTCCCCCAGCTG -3'

Posted On

2020-01-23