Incidental Mutation 'R8034:Ggcx'
ID 618126
Institutional Source Beutler Lab
Gene Symbol Ggcx
Ensembl Gene ENSMUSG00000053460
Gene Name gamma-glutamyl carboxylase
Synonyms vitamin K-dependent carboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 72414308-72430712 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72428604 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 529 (V529A)
Ref Sequence ENSEMBL: ENSMUSP00000070109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059472] [ENSMUST00000065906] [ENSMUST00000205335] [ENSMUST00000205738] [ENSMUST00000205823]
AlphaFold Q9QYC7
Predicted Effect probably benign
Transcript: ENSMUST00000059472
SMART Domains Protein: ENSMUSP00000087118
Gene: ENSMUSG00000053907

DomainStartEndE-ValueType
Pfam:S-AdoMet_synt_N 17 115 1.7e-45 PFAM
Pfam:S-AdoMet_synt_M 129 250 2.4e-47 PFAM
Pfam:S-AdoMet_synt_C 252 389 1.5e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065906
AA Change: V529A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: V529A

DomainStartEndE-ValueType
HTTM 56 315 1.34e-131 SMART
low complexity region 368 377 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132995
Predicted Effect probably benign
Transcript: ENSMUST00000205335
Predicted Effect probably benign
Transcript: ENSMUST00000205738
Predicted Effect probably benign
Transcript: ENSMUST00000205823
Predicted Effect probably benign
Transcript: ENSMUST00000207000
Predicted Effect probably benign
Transcript: ENSMUST00000207012
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Ggcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Ggcx APN 6 72429958 splice site probably null
IGL02373:Ggcx APN 6 72427919 missense probably damaging 1.00
IGL02589:Ggcx APN 6 72429148 missense probably damaging 1.00
IGL02634:Ggcx APN 6 72418303 missense probably damaging 1.00
IGL02661:Ggcx APN 6 72418360 missense possibly damaging 0.78
IGL02701:Ggcx APN 6 72418472 intron probably benign
R0503:Ggcx UTSW 6 72429157 frame shift probably null
R1034:Ggcx UTSW 6 72414831 missense probably damaging 1.00
R2219:Ggcx UTSW 6 72427982 missense probably benign 0.29
R3892:Ggcx UTSW 6 72418372 missense probably damaging 0.99
R3951:Ggcx UTSW 6 72426558 missense probably benign 0.01
R3952:Ggcx UTSW 6 72426558 missense probably benign 0.01
R4320:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4321:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4322:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4324:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4782:Ggcx UTSW 6 72428892 missense probably benign 0.01
R5370:Ggcx UTSW 6 72425931 missense possibly damaging 0.69
R5523:Ggcx UTSW 6 72424034 missense probably damaging 1.00
R5902:Ggcx UTSW 6 72429996 missense possibly damaging 0.92
R6126:Ggcx UTSW 6 72417983 missense possibly damaging 0.57
R6199:Ggcx UTSW 6 72430139 missense possibly damaging 0.57
R6223:Ggcx UTSW 6 72429605 missense probably damaging 0.97
R6515:Ggcx UTSW 6 72425832 missense probably benign 0.33
R7205:Ggcx UTSW 6 72428004 missense probably damaging 1.00
R7923:Ggcx UTSW 6 72427917 missense probably damaging 1.00
R8096:Ggcx UTSW 6 72429993 missense probably benign 0.33
R8116:Ggcx UTSW 6 72429528 missense possibly damaging 0.66
R8356:Ggcx UTSW 6 72429591 missense probably benign 0.03
R8977:Ggcx UTSW 6 72429282 critical splice donor site probably null
R9074:Ggcx UTSW 6 72425941 missense probably damaging 1.00
R9145:Ggcx UTSW 6 72425922 missense probably benign 0.18
R9285:Ggcx UTSW 6 72418419 nonsense probably null
R9362:Ggcx UTSW 6 72428032 missense probably damaging 1.00
R9497:Ggcx UTSW 6 72429207 missense probably damaging 1.00
Z1177:Ggcx UTSW 6 72426519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CCTCCTGAGAACATGGTTTCC -3'
(R):5'- AGTGTTGCCCAGGTCTTCAC -3'

Sequencing Primer
(F):5'- AGAACATGGTTTCCTTTTTGAAGGC -3'
(R):5'- ATTCTCCAAGTGAAGCCCTG -3'
Posted On 2020-01-23