Mutagenetix > Incidental Mutations

Incidental Mutation 'R8034:Ggcx'

618126

Institutional Source

Beutler Lab

Gene Symbol

Ggcx

Ensembl Gene

ENSMUSG00000053460

Gene Name

gamma-glutamyl carboxylase

Synonyms

vitamin K-dependent carboxylase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R8034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72414308-72430712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72428604 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 529 (V529A)

Ref Sequence

ENSEMBL: ENSMUSP00000070109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059472] [ENSMUST00000065906] [ENSMUST00000205335] [ENSMUST00000205738] [ENSMUST00000205823]

Predicted Effect

probably benign
Transcript: ENSMUST00000059472

SMART Domains

Protein: ENSMUSP00000087118
Gene: ENSMUSG00000053907

Domain	Start	End	E-Value	Type
Pfam:S-AdoMet_synt_N	17	115	1.7e-45	PFAM
Pfam:S-AdoMet_synt_M	129	250	2.4e-47	PFAM
Pfam:S-AdoMet_synt_C	252	389	1.5e-68	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065906
AA Change: V529A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: V529A

Domain	Start	End	E-Value	Type
HTTM	56	315	1.34e-131	SMART
low complexity region	368	377	N/A	INTRINSIC
low complexity region	630	645	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132995

Predicted Effect

probably benign
Transcript: ENSMUST00000205335

Predicted Effect

probably benign
Transcript: ENSMUST00000205738

Predicted Effect

probably benign
Transcript: ENSMUST00000205823

Predicted Effect

probably benign
Transcript: ENSMUST00000207000

Predicted Effect

probably benign
Transcript: ENSMUST00000207012

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Ggcx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01657:Ggcx	APN	6	72429958	splice site	probably null
IGL02373:Ggcx	APN	6	72427919	missense	probably damaging	1.00
IGL02589:Ggcx	APN	6	72429148	missense	probably damaging	1.00
IGL02634:Ggcx	APN	6	72418303	missense	probably damaging	1.00
IGL02661:Ggcx	APN	6	72418360	missense	possibly damaging	0.78
IGL02701:Ggcx	APN	6	72418472	intron	probably benign
R0503:Ggcx	UTSW	6	72429157	frame shift	probably null
R1034:Ggcx	UTSW	6	72414831	missense	probably damaging	1.00
R2219:Ggcx	UTSW	6	72427982	missense	probably benign	0.29
R3892:Ggcx	UTSW	6	72418372	missense	probably damaging	0.99
R3951:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R3952:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R4320:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4321:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4322:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4324:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4782:Ggcx	UTSW	6	72428892	missense	probably benign	0.01
R5370:Ggcx	UTSW	6	72425931	missense	possibly damaging	0.69
R5523:Ggcx	UTSW	6	72424034	missense	probably damaging	1.00
R5902:Ggcx	UTSW	6	72429996	missense	possibly damaging	0.92
R6126:Ggcx	UTSW	6	72417983	missense	possibly damaging	0.57
R6199:Ggcx	UTSW	6	72430139	missense	possibly damaging	0.57
R6223:Ggcx	UTSW	6	72429605	missense	probably damaging	0.97
R6515:Ggcx	UTSW	6	72425832	missense	probably benign	0.33
R7205:Ggcx	UTSW	6	72428004	missense	probably damaging	1.00
R7923:Ggcx	UTSW	6	72427917	missense	probably damaging	1.00
R8096:Ggcx	UTSW	6	72429993	missense	probably benign	0.33
R8116:Ggcx	UTSW	6	72429528	missense	possibly damaging	0.66
R8356:Ggcx	UTSW	6	72429591	missense	probably benign	0.03
Z1177:Ggcx	UTSW	6	72426519	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- CCTCCTGAGAACATGGTTTCC -3'
(R):5'- AGTGTTGCCCAGGTCTTCAC -3'

Sequencing Primer
(F):5'- AGAACATGGTTTCCTTTTTGAAGGC -3'
(R):5'- ATTCTCCAAGTGAAGCCCTG -3'

Posted On

2020-01-23