Incidental Mutation 'R8034:Sec13'
ID 618128
Institutional Source Beutler Lab
Gene Symbol Sec13
Ensembl Gene ENSMUSG00000030298
Gene Name SEC13 homolog, nuclear pore and COPII coat complex component
Synonyms 1110003H02Rik, Sec13l1, Sec13r
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 113705013-113717642 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113712050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 95 (K95R)
Ref Sequence ENSEMBL: ENSMUSP00000032440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032440]
AlphaFold Q9D1M0
Predicted Effect probably benign
Transcript: ENSMUST00000032440
AA Change: K95R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032440
Gene: ENSMUSG00000030298
AA Change: K95R

DomainStartEndE-ValueType
WD40 1 41 7.39e-3 SMART
WD40 46 87 5.55e-7 SMART
WD40 92 133 8.75e-5 SMART
WD40 139 195 2.67e-1 SMART
WD40 201 244 6.73e-6 SMART
WD40 254 290 9.75e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
H2-Q10 A T 17: 35,781,338 (GRCm39) I47F probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lcn6 T A 2: 25,566,883 (GRCm39) L19* probably null Het
Lhcgr T C 17: 89,049,784 (GRCm39) T581A probably damaging Het
Map4k1 T C 7: 28,687,573 (GRCm39) I203T probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Npas3 T A 12: 53,687,312 (GRCm39) I159N probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sema5a A G 15: 32,574,987 (GRCm39) Y365C probably damaging Het
Sp140l2 T A 1: 85,231,881 (GRCm39) T180S probably benign Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in Sec13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Sec13 APN 6 113,713,381 (GRCm39) missense probably damaging 1.00
BB005:Sec13 UTSW 6 113,706,601 (GRCm39) missense probably damaging 1.00
BB015:Sec13 UTSW 6 113,706,601 (GRCm39) missense probably damaging 1.00
R0470:Sec13 UTSW 6 113,717,593 (GRCm39) unclassified probably benign
R0507:Sec13 UTSW 6 113,712,080 (GRCm39) missense probably damaging 1.00
R1269:Sec13 UTSW 6 113,714,956 (GRCm39) missense probably damaging 0.98
R4120:Sec13 UTSW 6 113,711,637 (GRCm39) missense probably damaging 1.00
R4624:Sec13 UTSW 6 113,706,652 (GRCm39) missense probably benign 0.02
R4938:Sec13 UTSW 6 113,712,153 (GRCm39) missense probably damaging 1.00
R5156:Sec13 UTSW 6 113,707,837 (GRCm39) missense probably benign 0.05
R6065:Sec13 UTSW 6 113,707,793 (GRCm39) missense probably benign 0.01
R6302:Sec13 UTSW 6 113,712,167 (GRCm39) missense probably damaging 1.00
R7265:Sec13 UTSW 6 113,712,097 (GRCm39) nonsense probably null
R7928:Sec13 UTSW 6 113,706,601 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGCTGAGCTTGGAAAG -3'
(R):5'- AACTGGTACTGTGTGTCCCCTG -3'

Sequencing Primer
(F):5'- GGAAAGCCTCACTGTTCTTACTAAAC -3'
(R):5'- TGACCCTCTGAGCAGCCTG -3'
Posted On 2020-01-23