Incidental Mutation 'R8034:Sec13'
ID618128
Institutional Source Beutler Lab
Gene Symbol Sec13
Ensembl Gene ENSMUSG00000030298
Gene NameSEC13 homolog, nuclear pore and COPII coat complex component
Synonyms1110003H02Rik, Sec13r, Sec13l1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113728062-113740743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113735089 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 95 (K95R)
Ref Sequence ENSEMBL: ENSMUSP00000032440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032440]
Predicted Effect probably benign
Transcript: ENSMUST00000032440
AA Change: K95R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032440
Gene: ENSMUSG00000030298
AA Change: K95R

DomainStartEndE-ValueType
WD40 1 41 7.39e-3 SMART
WD40 46 87 5.55e-7 SMART
WD40 92 133 8.75e-5 SMART
WD40 139 195 2.67e-1 SMART
WD40 201 244 6.73e-6 SMART
WD40 254 290 9.75e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Sec13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Sec13 APN 6 113736420 missense probably damaging 1.00
BB005:Sec13 UTSW 6 113729640 missense probably damaging 1.00
BB015:Sec13 UTSW 6 113729640 missense probably damaging 1.00
R0470:Sec13 UTSW 6 113740632 unclassified probably benign
R0507:Sec13 UTSW 6 113735119 missense probably damaging 1.00
R1269:Sec13 UTSW 6 113737995 missense probably damaging 0.98
R4120:Sec13 UTSW 6 113734676 missense probably damaging 1.00
R4624:Sec13 UTSW 6 113729691 missense probably benign 0.02
R4938:Sec13 UTSW 6 113735192 missense probably damaging 1.00
R5156:Sec13 UTSW 6 113730876 missense probably benign 0.05
R6065:Sec13 UTSW 6 113730832 missense probably benign 0.01
R6302:Sec13 UTSW 6 113735206 missense probably damaging 1.00
R7265:Sec13 UTSW 6 113735136 nonsense probably null
R7928:Sec13 UTSW 6 113729640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGCTGAGCTTGGAAAG -3'
(R):5'- AACTGGTACTGTGTGTCCCCTG -3'

Sequencing Primer
(F):5'- GGAAAGCCTCACTGTTCTTACTAAAC -3'
(R):5'- TGACCCTCTGAGCAGCCTG -3'
Posted On2020-01-23