Incidental Mutation 'R8034:Map4k1'
ID 618129
Institutional Source Beutler Lab
Gene Symbol Map4k1
Ensembl Gene ENSMUSG00000037337
Gene Name mitogen-activated protein kinase kinase kinase kinase 1
Synonyms Hpk1
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 28681475-28702704 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28687573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 203 (I203T)
Ref Sequence ENSEMBL: ENSMUSP00000082995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085835] [ENSMUST00000207185] [ENSMUST00000208227]
AlphaFold P70218
PDB Structure MONA/GADS SH3C IN COMPLEX WITH HPK DERIVED PEPTIDE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000085835
AA Change: I203T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082995
Gene: ENSMUSG00000037337
AA Change: I203T

DomainStartEndE-ValueType
S_TKc 17 274 3.58e-84 SMART
low complexity region 301 318 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 385 416 N/A INTRINSIC
low complexity region 426 446 N/A INTRINSIC
CNH 506 813 4.93e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207185
AA Change: I203T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208227
AA Change: I157T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have increased responses of B and T cells. Dendritic cells are also hyperresponsive to stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
H2-Q10 A T 17: 35,781,338 (GRCm39) I47F probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lcn6 T A 2: 25,566,883 (GRCm39) L19* probably null Het
Lhcgr T C 17: 89,049,784 (GRCm39) T581A probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Npas3 T A 12: 53,687,312 (GRCm39) I159N probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sec13 T C 6: 113,712,050 (GRCm39) K95R probably benign Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sema5a A G 15: 32,574,987 (GRCm39) Y365C probably damaging Het
Sp140l2 T A 1: 85,231,881 (GRCm39) T180S probably benign Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in Map4k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Map4k1 APN 7 28,701,044 (GRCm39) missense probably damaging 0.98
IGL01936:Map4k1 APN 7 28,688,032 (GRCm39) missense possibly damaging 0.90
IGL02473:Map4k1 APN 7 28,699,297 (GRCm39) missense probably damaging 1.00
IGL02934:Map4k1 APN 7 28,693,531 (GRCm39) missense probably benign 0.00
IGL03180:Map4k1 APN 7 28,687,510 (GRCm39) missense probably damaging 1.00
IGL03199:Map4k1 APN 7 28,682,842 (GRCm39) missense probably damaging 1.00
IGL03493:Map4k1 APN 7 28,683,576 (GRCm39) unclassified probably benign
R0333:Map4k1 UTSW 7 28,699,186 (GRCm39) unclassified probably benign
R1296:Map4k1 UTSW 7 28,697,877 (GRCm39) missense possibly damaging 0.96
R1305:Map4k1 UTSW 7 28,694,890 (GRCm39) missense probably benign
R1519:Map4k1 UTSW 7 28,690,461 (GRCm39) missense probably benign 0.00
R1711:Map4k1 UTSW 7 28,688,777 (GRCm39) missense possibly damaging 0.80
R1842:Map4k1 UTSW 7 28,686,588 (GRCm39) missense probably damaging 1.00
R1851:Map4k1 UTSW 7 28,699,209 (GRCm39) missense probably benign
R2042:Map4k1 UTSW 7 28,683,555 (GRCm39) missense probably damaging 1.00
R2274:Map4k1 UTSW 7 28,701,382 (GRCm39) missense probably damaging 1.00
R2275:Map4k1 UTSW 7 28,701,382 (GRCm39) missense probably damaging 1.00
R4426:Map4k1 UTSW 7 28,688,020 (GRCm39) missense probably damaging 1.00
R4568:Map4k1 UTSW 7 28,686,079 (GRCm39) missense probably damaging 1.00
R4858:Map4k1 UTSW 7 28,688,195 (GRCm39) missense probably damaging 1.00
R4903:Map4k1 UTSW 7 28,682,427 (GRCm39) missense probably benign 0.01
R4964:Map4k1 UTSW 7 28,682,427 (GRCm39) missense probably benign 0.01
R4966:Map4k1 UTSW 7 28,682,427 (GRCm39) missense probably benign 0.01
R5124:Map4k1 UTSW 7 28,688,257 (GRCm39) missense probably damaging 1.00
R5778:Map4k1 UTSW 7 28,693,646 (GRCm39) missense probably benign 0.37
R5786:Map4k1 UTSW 7 28,699,445 (GRCm39) missense probably damaging 1.00
R6343:Map4k1 UTSW 7 28,699,715 (GRCm39) missense possibly damaging 0.76
R6475:Map4k1 UTSW 7 28,686,447 (GRCm39) missense probably damaging 1.00
R6702:Map4k1 UTSW 7 28,701,821 (GRCm39) missense possibly damaging 0.86
R6703:Map4k1 UTSW 7 28,701,821 (GRCm39) missense possibly damaging 0.86
R6856:Map4k1 UTSW 7 28,686,259 (GRCm39) missense probably damaging 1.00
R6870:Map4k1 UTSW 7 28,701,096 (GRCm39) critical splice donor site probably null
R6904:Map4k1 UTSW 7 28,686,227 (GRCm39) missense probably damaging 1.00
R7081:Map4k1 UTSW 7 28,690,574 (GRCm39) missense probably benign
R7572:Map4k1 UTSW 7 28,686,563 (GRCm39) missense probably benign 0.01
R7868:Map4k1 UTSW 7 28,699,387 (GRCm39) critical splice acceptor site probably null
R8054:Map4k1 UTSW 7 28,689,181 (GRCm39) splice site probably benign
R8512:Map4k1 UTSW 7 28,695,583 (GRCm39) missense possibly damaging 0.88
R8686:Map4k1 UTSW 7 28,693,498 (GRCm39) missense probably benign 0.04
R8723:Map4k1 UTSW 7 28,686,542 (GRCm39) missense probably damaging 0.99
R8743:Map4k1 UTSW 7 28,686,542 (GRCm39) missense probably damaging 0.99
R8745:Map4k1 UTSW 7 28,686,542 (GRCm39) missense probably damaging 0.99
R8885:Map4k1 UTSW 7 28,688,862 (GRCm39) missense probably benign 0.00
R8921:Map4k1 UTSW 7 28,701,052 (GRCm39) missense probably damaging 0.96
R9518:Map4k1 UTSW 7 28,693,496 (GRCm39) missense probably benign 0.00
Z1177:Map4k1 UTSW 7 28,699,433 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCAACTTTGTCTTGGTATCCTTC -3'
(R):5'- GTTTCAGGAGTTCCCCATGGA -3'

Sequencing Primer
(F):5'- GGTATCCTTCTCCCCTGCTG -3'
(R):5'- GCCTGAGGATCTGAGTTCAAATCC -3'
Posted On 2020-01-23