Incidental Mutation 'R8034:Dpy19l3'
ID618130
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35749856 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 41 (F41L)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377]
Predicted Effect probably benign
Transcript: ENSMUST00000051377
AA Change: F41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: F41L

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35695316 missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4438:Dpy19l3 UTSW 7 35692859 missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35708042 intron probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35708630 missense probably benign
R7198:Dpy19l3 UTSW 7 35749765 missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R8073:Dpy19l3 UTSW 7 35729748 missense probably damaging 1.00
R8183:Dpy19l3 UTSW 7 35695389 missense not run
R8206:Dpy19l3 UTSW 7 35729730 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGCTACCGGGGAAACAAATG -3'
(R):5'- GCGCATGTCTTCTGATTTATGC -3'

Sequencing Primer
(F):5'- CTACCGGGGAAACAAATGAGTTGATC -3'
(R):5'- TGTGTAGGTTGTACAAATGAGCACC -3'
Posted On2020-01-23