Incidental Mutation 'R8034:Fuz'
ID618131
Institutional Source Beutler Lab
Gene Symbol Fuz
Ensembl Gene ENSMUSG00000011658
Gene Namefuzzy planar cell polarity protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44896079-44902631 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 44896260 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000146820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003049] [ENSMUST00000071207] [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930] [ENSMUST00000207069] [ENSMUST00000207154] [ENSMUST00000207278] [ENSMUST00000207485] [ENSMUST00000207654] [ENSMUST00000207788] [ENSMUST00000207939] [ENSMUST00000208179] [ENSMUST00000208253] [ENSMUST00000208551] [ENSMUST00000208556] [ENSMUST00000208600] [ENSMUST00000209039] [ENSMUST00000209132] [ENSMUST00000209163]
Predicted Effect probably benign
Transcript: ENSMUST00000003049
SMART Domains Protein: ENSMUSP00000003049
Gene: ENSMUSG00000002968

DomainStartEndE-ValueType
VWA 15 178 6.55e0 SMART
low complexity region 193 211 N/A INTRINSIC
Pfam:Med25_SD1 228 383 5.8e-55 PFAM
Pfam:Med25 396 546 3.9e-64 PFAM
low complexity region 577 592 N/A INTRINSIC
low complexity region 596 632 N/A INTRINSIC
Pfam:Med25_NR-box 657 745 5.3e-43 PFAM
Predicted Effect silent
Transcript: ENSMUST00000071207
SMART Domains Protein: ENSMUSP00000071194
Gene: ENSMUSG00000011658

DomainStartEndE-ValueType
low complexity region 234 259 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
low complexity region 382 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085399
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107857
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166972
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167930
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect silent
Transcript: ENSMUST00000207069
Predicted Effect silent
Transcript: ENSMUST00000207154
Predicted Effect probably benign
Transcript: ENSMUST00000207278
Predicted Effect silent
Transcript: ENSMUST00000207485
Predicted Effect probably benign
Transcript: ENSMUST00000207490
Predicted Effect probably benign
Transcript: ENSMUST00000207654
Predicted Effect probably benign
Transcript: ENSMUST00000207788
Predicted Effect probably null
Transcript: ENSMUST00000207939
AA Change: M1T
Predicted Effect silent
Transcript: ENSMUST00000208179
Predicted Effect probably benign
Transcript: ENSMUST00000208253
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Predicted Effect probably benign
Transcript: ENSMUST00000208551
Predicted Effect probably benign
Transcript: ENSMUST00000208556
Predicted Effect silent
Transcript: ENSMUST00000208600
Predicted Effect probably benign
Transcript: ENSMUST00000208908
Predicted Effect silent
Transcript: ENSMUST00000209039
Predicted Effect silent
Transcript: ENSMUST00000209132
Predicted Effect probably benign
Transcript: ENSMUST00000209163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit neural tube closure defects, abnormal craniofacial morphology, abnormal skeletal morphology, polydactyly, anopthalmia, pulmonary hopyplasia, and cardiac outflow tract defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Fuz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Fuz APN 7 44896959 missense probably damaging 1.00
R0211:Fuz UTSW 7 44899022 unclassified probably null
R0586:Fuz UTSW 7 44898558 missense possibly damaging 0.59
R1028:Fuz UTSW 7 44896926 missense probably damaging 1.00
R1720:Fuz UTSW 7 44896991 missense probably damaging 1.00
R4969:Fuz UTSW 7 44900294 missense probably damaging 1.00
R5278:Fuz UTSW 7 44896277 missense probably benign 0.11
R5870:Fuz UTSW 7 44900318 missense probably damaging 1.00
R6972:Fuz UTSW 7 44897331 critical splice donor site probably benign
R7440:Fuz UTSW 7 44896572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATCCTGTTGGAGGGGC -3'
(R):5'- AAAGTTCTTCAGGAAACCAGGC -3'

Sequencing Primer
(F):5'- CTGAGTTGATGAAGGCAGGAATTTAG -3'
(R):5'- AGGCTTATTAGTCCCCTAAAGGC -3'
Posted On2020-01-23