Incidental Mutation 'R8034:Olfr572'
ID618134
Institutional Source Beutler Lab
Gene Symbol Olfr572
Ensembl Gene ENSMUSG00000073963
Gene Nameolfactory receptor 572
SynonymsGA_x6K02T2PBJ9-5638785-5639741, MOR10-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102924409-102928608 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 102928566 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 313 (K313*)
Ref Sequence ENSEMBL: ENSMUSP00000149174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098214] [ENSMUST00000214096] [ENSMUST00000215782]
Predicted Effect probably null
Transcript: ENSMUST00000098214
AA Change: K313*
SMART Domains Protein: ENSMUSP00000095816
Gene: ENSMUSG00000073963
AA Change: K313*

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 37 309 2e-7 PFAM
Pfam:7tm_1 43 294 1e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214096
AA Change: K313*
Predicted Effect probably null
Transcript: ENSMUST00000215782
AA Change: K313*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Olfr572
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Olfr572 APN 7 102928416 missense probably benign 0.03
IGL02015:Olfr572 APN 7 102928192 missense probably benign 0.06
IGL02466:Olfr572 APN 7 102928516 missense possibly damaging 0.88
R0632:Olfr572 UTSW 7 102928604 utr 3 prime probably null
R1852:Olfr572 UTSW 7 102928441 missense probably damaging 1.00
R2033:Olfr572 UTSW 7 102928408 missense probably benign 0.00
R2679:Olfr572 UTSW 7 102928031 nonsense probably null
R4520:Olfr572 UTSW 7 102928557 missense probably benign
R4596:Olfr572 UTSW 7 102928251 missense possibly damaging 0.74
R5538:Olfr572 UTSW 7 102928521 missense probably damaging 1.00
R6477:Olfr572 UTSW 7 102928378 missense probably damaging 1.00
R7028:Olfr572 UTSW 7 102927942 missense probably damaging 1.00
Z1177:Olfr572 UTSW 7 102927644 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGCTCTCAACACCTGTG -3'
(R):5'- TTGGCACATGTGAAATGAAGTATC -3'

Sequencing Primer
(F):5'- GTGTGTCCCACATCTGTGCTG -3'
(R):5'- TCAACTCACACAGAGAACTTTA -3'
Posted On2020-01-23