Incidental Mutation 'R8034:Bean1'
ID618136
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Namebrain expressed, associated with Nedd4, 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8034 (G1)
Quality Score214.458
Status Not validated
Chromosome8
Chromosomal Location104170442-104219122 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CT to C at 104182032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
Predicted Effect probably benign
Transcript: ENSMUST00000093245
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153288
Predicted Effect probably benign
Transcript: ENSMUST00000164076
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167633
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171018
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212979
Predicted Effect probably benign
Transcript: ENSMUST00000213077
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104210918 missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104217175 missense probably damaging 1.00
R0490:Bean1 UTSW 8 104215028 missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104217224 missense probably benign
R1920:Bean1 UTSW 8 104211110 missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104182011 missense probably benign 0.04
R3980:Bean1 UTSW 8 104211098 missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104213934 start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104217110 missense probably damaging 1.00
R4516:Bean1 UTSW 8 104215154 missense probably damaging 1.00
R4542:Bean1 UTSW 8 104210959 missense probably damaging 1.00
R4663:Bean1 UTSW 8 104211167 missense probably damaging 1.00
R4962:Bean1 UTSW 8 104216974 missense probably damaging 1.00
R5221:Bean1 UTSW 8 104215152 missense probably damaging 1.00
R6288:Bean1 UTSW 8 104210990 missense probably damaging 1.00
R6588:Bean1 UTSW 8 104182032 frame shift probably null
R6615:Bean1 UTSW 8 104182032 frame shift probably null
R6994:Bean1 UTSW 8 104182032 frame shift probably null
R7359:Bean1 UTSW 8 104182032 frame shift probably null
R7451:Bean1 UTSW 8 104213996 missense probably benign 0.01
R7454:Bean1 UTSW 8 104211026 missense probably damaging 1.00
R7473:Bean1 UTSW 8 104182032 frame shift probably null
R7537:Bean1 UTSW 8 104182032 frame shift probably null
R7826:Bean1 UTSW 8 104182032 frame shift probably null
RF054:Bean1 UTSW 8 104182032 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGTGACCTCAATACCCCATGTG -3'
(R):5'- TCCACACTAGCCTTGGTCAG -3'

Sequencing Primer
(F):5'- GACCTCAATACCCCATGTGATATTC -3'
(R):5'- CTTGGTCAGGCTCAGTGC -3'
Posted On2020-01-23