Mutagenetix > Incidental Mutation

Incidental Mutation 'R8034:Bean1'

618136

Institutional Source

Beutler Lab

Gene Symbol

Bean1

Ensembl Gene

ENSMUSG00000031872

Gene Name

brain expressed, associated with Nedd4, 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8034 (G1)

Quality Score

214.458

Status

Not validated

Chromosome

Chromosomal Location

104170442-104219122 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CT to C at 104182032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]

AlphaFold

Q9EQG5

Predicted Effect

probably benign
Transcript: ENSMUST00000093245

SMART Domains

Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153288

Predicted Effect

probably benign
Transcript: ENSMUST00000164076

SMART Domains

Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
low complexity region	156	171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167633

SMART Domains

Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171018

SMART Domains

Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	72	94	N/A	INTRINSIC
low complexity region	104	124	N/A	INTRINSIC
low complexity region	288	303	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000212979

Predicted Effect

probably benign
Transcript: ENSMUST00000213077

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Bean1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02016:Bean1	APN	8	104210918	missense	possibly damaging	0.90
R0135:Bean1	UTSW	8	104217175	missense	probably damaging	1.00
R0490:Bean1	UTSW	8	104215028	missense	possibly damaging	0.76
R1319:Bean1	UTSW	8	104217224	missense	probably benign
R1920:Bean1	UTSW	8	104211110	missense	possibly damaging	0.92
R2513:Bean1	UTSW	8	104182011	missense	probably benign	0.04
R3980:Bean1	UTSW	8	104211098	missense	possibly damaging	0.92
R4209:Bean1	UTSW	8	104213934	start codon destroyed	probably null	0.04
R4369:Bean1	UTSW	8	104217110	missense	probably damaging	1.00
R4516:Bean1	UTSW	8	104215154	missense	probably damaging	1.00
R4542:Bean1	UTSW	8	104210959	missense	probably damaging	1.00
R4663:Bean1	UTSW	8	104211167	missense	probably damaging	1.00
R4962:Bean1	UTSW	8	104216974	missense	probably damaging	1.00
R5221:Bean1	UTSW	8	104215152	missense	probably damaging	1.00
R6288:Bean1	UTSW	8	104210990	missense	probably damaging	1.00
R6588:Bean1	UTSW	8	104182032	frame shift	probably null
R6615:Bean1	UTSW	8	104182032	frame shift	probably null
R6994:Bean1	UTSW	8	104182032	frame shift	probably null
R7359:Bean1	UTSW	8	104182032	frame shift	probably null
R7451:Bean1	UTSW	8	104213996	missense	probably benign	0.01
R7454:Bean1	UTSW	8	104211026	missense	probably damaging	1.00
R7473:Bean1	UTSW	8	104182032	frame shift	probably null
R7537:Bean1	UTSW	8	104182032	frame shift	probably null
R7826:Bean1	UTSW	8	104182032	frame shift	probably null
R8418:Bean1	UTSW	8	104182032	frame shift	probably null
R8789:Bean1	UTSW	8	104182032	frame shift	probably null
R8885:Bean1	UTSW	8	104182120	critical splice donor site	probably null
R8888:Bean1	UTSW	8	104182032	frame shift	probably null
R8892:Bean1	UTSW	8	104216978	missense	probably damaging	1.00
R8896:Bean1	UTSW	8	104182032	frame shift	probably null
R8992:Bean1	UTSW	8	104182032	frame shift	probably null
R9015:Bean1	UTSW	8	104182032	frame shift	probably null
R9113:Bean1	UTSW	8	104213925	missense	probably benign	0.00
R9122:Bean1	UTSW	8	104182032	frame shift	probably null
R9135:Bean1	UTSW	8	104182032	frame shift	probably null
R9151:Bean1	UTSW	8	104182032	frame shift	probably null
R9255:Bean1	UTSW	8	104182032	frame shift	probably null
R9340:Bean1	UTSW	8	104182107	missense	probably damaging	0.99
R9363:Bean1	UTSW	8	104182032	frame shift	probably null
R9417:Bean1	UTSW	8	104182032	frame shift	probably null
R9537:Bean1	UTSW	8	104182032	frame shift	probably null
R9566:Bean1	UTSW	8	104182032	frame shift	probably null
R9731:Bean1	UTSW	8	104182032	frame shift	probably null
RF054:Bean1	UTSW	8	104182032	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTGACCTCAATACCCCATGTG -3'
(R):5'- TCCACACTAGCCTTGGTCAG -3'

Sequencing Primer
(F):5'- GACCTCAATACCCCATGTGATATTC -3'
(R):5'- CTTGGTCAGGCTCAGTGC -3'

Posted On

2020-01-23