Incidental Mutation 'R8034:Olfr890'
ID618138
Institutional Source Beutler Lab
Gene Symbol Olfr890
Ensembl Gene ENSMUSG00000096409
Gene Nameolfactory receptor 890
SynonymsMOR162-3, MOR162-15_p, GA_x6K02T2PVTD-31822365-31823309
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38142517-38148375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38143677 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 176 (Y176H)
Ref Sequence ENSEMBL: ENSMUSP00000149829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079804] [ENSMUST00000213458]
Predicted Effect probably damaging
Transcript: ENSMUST00000079804
AA Change: Y181H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078733
Gene: ENSMUSG00000096409
AA Change: Y181H

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 2.3e-48 PFAM
Pfam:7tm_1 46 293 9.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213458
AA Change: Y176H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Olfr890
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Olfr890 APN 9 38143871 nonsense probably null
IGL01861:Olfr890 APN 9 38143750 missense probably damaging 1.00
IGL02174:Olfr890 APN 9 38143785 missense possibly damaging 0.90
IGL02723:Olfr890 APN 9 38143411 missense probably benign 0.02
IGL03085:Olfr890 APN 9 38143183 missense probably damaging 0.98
FR4449:Olfr890 UTSW 9 38143188 missense probably benign 0.00
FR4737:Olfr890 UTSW 9 38143188 missense probably benign 0.00
R0637:Olfr890 UTSW 9 38143882 missense probably benign 0.00
R1353:Olfr890 UTSW 9 38143728 missense probably benign 0.03
R1813:Olfr890 UTSW 9 38143729 missense possibly damaging 0.78
R5997:Olfr890 UTSW 9 38143801 missense probably damaging 1.00
R6004:Olfr890 UTSW 9 38143960 missense probably damaging 1.00
R6417:Olfr890 UTSW 9 38143315 missense probably damaging 1.00
R6420:Olfr890 UTSW 9 38143315 missense probably damaging 1.00
R6720:Olfr890 UTSW 9 38143153 start codon destroyed probably null 1.00
R7223:Olfr890 UTSW 9 38143753 missense probably benign 0.02
R7601:Olfr890 UTSW 9 38143378 missense probably benign 0.13
R7671:Olfr890 UTSW 9 38143440 missense probably benign 0.02
Z1176:Olfr890 UTSW 9 38143431 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTTGACAGCAATGGCCTATG -3'
(R):5'- AGCTATGAAATGGGAGCCAC -3'

Sequencing Primer
(F):5'- CAATGGCCTATGACAGATATGC -3'
(R):5'- ACAGGTCCTGAATGCTTTTGAC -3'
Posted On2020-01-23