Incidental Mutation 'R8034:Asb3'
ID618141
Institutional Source Beutler Lab
Gene Symbol Asb3
Ensembl Gene ENSMUSG00000020305
Gene Nameankyrin repeat and SOCS box-containing 3
Synonyms2400011J03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location30885416-31102704 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 31081554 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 391 (Y391*)
Ref Sequence ENSEMBL: ENSMUSP00000020551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000117883] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably null
Transcript: ENSMUST00000020551
AA Change: Y391*
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305
AA Change: Y391*

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117883
AA Change: Y391*
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305
AA Change: Y391*

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203878
AA Change: Y430*
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305
AA Change: Y430*

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Asb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:Asb3 APN 11 31101067 missense probably damaging 1.00
IGL02932:Asb3 APN 11 31029067 critical splice donor site probably null
Kickbox UTSW 11 30998326 missense probably damaging 1.00
low_blow UTSW 11 30998348 nonsense probably null
Octagon UTSW 11 30998321 missense probably benign 0.34
penalty UTSW 11 31081357 splice site probably null
sixpack UTSW 11 31085143 missense probably benign
R0573:Asb3 UTSW 11 31061406 missense probably damaging 0.99
R1395:Asb3 UTSW 11 31101032 splice site probably benign
R1545:Asb3 UTSW 11 31056217 missense probably benign 0.00
R2108:Asb3 UTSW 11 31081355 splice site probably null
R2364:Asb3 UTSW 11 31101192 missense probably benign 0.01
R4527:Asb3 UTSW 11 31058933 missense probably benign 0.30
R5019:Asb3 UTSW 11 31081415 missense possibly damaging 0.95
R5176:Asb3 UTSW 11 31081357 splice site probably null
R5344:Asb3 UTSW 11 31101114 missense probably benign 0.01
R5734:Asb3 UTSW 11 31029021 missense probably damaging 1.00
R6251:Asb3 UTSW 11 31055559 missense probably damaging 1.00
R6265:Asb3 UTSW 11 31085143 missense probably benign
R6747:Asb3 UTSW 11 31081493 missense probably benign 0.01
R6827:Asb3 UTSW 11 31101211 missense probably benign 0.00
R6928:Asb3 UTSW 11 30998326 missense probably damaging 1.00
R7048:Asb3 UTSW 11 31101121 missense probably damaging 1.00
R7087:Asb3 UTSW 11 30998321 missense probably benign 0.34
R7135:Asb3 UTSW 11 30998501 nonsense probably null
R7165:Asb3 UTSW 11 31029029 missense probably damaging 0.99
R7200:Asb3 UTSW 11 30998348 nonsense probably null
R7265:Asb3 UTSW 11 30998495 missense probably benign 0.02
R7509:Asb3 UTSW 11 30998507 missense probably benign 0.12
R7674:Asb3 UTSW 11 31081435 missense possibly damaging 0.92
R8029:Asb3 UTSW 11 31101180 nonsense probably null
R8061:Asb3 UTSW 11 30998447 missense probably damaging 1.00
RF016:Asb3 UTSW 11 31061407 missense possibly damaging 0.95
X0024:Asb3 UTSW 11 31058950 missense probably damaging 0.97
Z1177:Asb3 UTSW 11 31058965 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCATGTAAAAGCCATTGGTTATACC -3'
(R):5'- GTCAATACTCTCACGCAATGCAG -3'

Sequencing Primer
(F):5'- ACCAAGTGCTATTTTCATTTCCAG -3'
(R):5'- CTCTCACGCAATGCAGATATGGTG -3'
Posted On2020-01-23