Mutagenetix > Incidental Mutation

Incidental Mutation 'R8034:Npas3'

618143

Institutional Source

Beutler Lab

Gene Symbol

Npas3

Ensembl Gene

ENSMUSG00000021010

Gene Name

neuronal PAS domain protein 3

Synonyms

4930423H22Rik, bHLHe12

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R8034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53248677-54072175 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53640529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 159 (I159N)

Ref Sequence

ENSEMBL: ENSMUSP00000098975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000101432
AA Change: I159N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: I159N

Domain	Start	End	E-Value	Type
HLH	64	119	1.34e-6	SMART
PAS	154	220	8.69e-11	SMART
low complexity region	234	256	N/A	INTRINSIC
PAS	326	392	7.4e-5	SMART
PAC	398	441	2.46e-1	SMART
low complexity region	461	477	N/A	INTRINSIC
low complexity region	524	544	N/A	INTRINSIC
low complexity region	598	627	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	739	754	N/A	INTRINSIC
low complexity region	759	773	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223057
AA Change: I141N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223358
AA Change: I131N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Npas3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Npas3	APN	12	54003560	missense	probably damaging	1.00
IGL01330:Npas3	APN	12	54048819	missense	probably damaging	1.00
IGL01376:Npas3	APN	12	54044586	missense	probably benign	0.01
IGL01634:Npas3	APN	12	53947163	missense	probably damaging	1.00
IGL02456:Npas3	APN	12	54048767	missense	probably damaging	0.99
IGL02663:Npas3	APN	12	54068908	missense	probably damaging	1.00
IGL02731:Npas3	APN	12	54067795	missense	probably benign	0.01
IGL02955:Npas3	APN	12	53501265	missense	probably damaging	0.96
IGL03001:Npas3	APN	12	53501192	missense	probably damaging	1.00
IGL03047:Npas3	APN	12	53831687	splice site	probably benign
ANU05:Npas3	UTSW	12	54068074	missense	possibly damaging	0.49
IGL02837:Npas3	UTSW	12	53947197	missense	possibly damaging	0.79
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0396:Npas3	UTSW	12	53831745	missense	probably damaging	1.00
R1687:Npas3	UTSW	12	54048875	splice site	probably null
R1863:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R2004:Npas3	UTSW	12	54067897	missense	possibly damaging	0.63
R2047:Npas3	UTSW	12	54068829	missense	probably damaging	0.99
R2049:Npas3	UTSW	12	54062088	missense	probably damaging	1.00
R2278:Npas3	UTSW	12	53640502	missense	possibly damaging	0.92
R2323:Npas3	UTSW	12	54068346	missense	probably damaging	1.00
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R3116:Npas3	UTSW	12	54067725	splice site	probably null
R3431:Npas3	UTSW	12	54069049	missense	probably damaging	0.99
R3731:Npas3	UTSW	12	53354392	missense	probably benign	0.11
R3767:Npas3	UTSW	12	54069074	makesense	probably null
R4332:Npas3	UTSW	12	54062069	missense	probably damaging	0.99
R4593:Npas3	UTSW	12	54068497	missense	probably benign	0.08
R4601:Npas3	UTSW	12	54044578	missense	probably damaging	0.99
R4654:Npas3	UTSW	12	54062132	critical splice donor site	probably null
R4946:Npas3	UTSW	12	54065835	missense	probably damaging	1.00
R5140:Npas3	UTSW	12	53501114	nonsense	probably null
R5302:Npas3	UTSW	12	54068836	missense	probably damaging	1.00
R5524:Npas3	UTSW	12	54068938	missense	possibly damaging	0.64
R5735:Npas3	UTSW	12	54003479	missense	probably benign	0.00
R6252:Npas3	UTSW	12	54068890	missense	probably damaging	1.00
R6438:Npas3	UTSW	12	54068698	missense	probably damaging	0.99
R6987:Npas3	UTSW	12	54068253	missense	possibly damaging	0.94
R6994:Npas3	UTSW	12	54068793	missense	probably damaging	0.96
R7304:Npas3	UTSW	12	54069041	missense	probably damaging	1.00
R7684:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R7724:Npas3	UTSW	12	54068341	missense	possibly damaging	0.90
R7739:Npas3	UTSW	12	54068718	missense	probably damaging	1.00
R7826:Npas3	UTSW	12	53831756	missense	possibly damaging	0.92
R8017:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8019:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8422:Npas3	UTSW	12	54068509	missense	probably benign
R9172:Npas3	UTSW	12	54065870	missense	probably benign	0.08
R9207:Npas3	UTSW	12	54068035	missense	possibly damaging	0.87
R9774:Npas3	UTSW	12	53947325	missense	probably damaging	1.00
X0003:Npas3	UTSW	12	54044728	splice site	probably null
X0064:Npas3	UTSW	12	53354384	missense	probably damaging	0.96
Z1176:Npas3	UTSW	12	53501180	missense	probably damaging	0.99
Z1177:Npas3	UTSW	12	53947206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGACCAGCGTTTCTTTCAGAAC -3'
(R):5'- TCCCTCAAGGAATGGCTTTC -3'

Sequencing Primer
(F):5'- CAGAACTCATTGATGCTTTAGCGG -3'
(R):5'- TGGCTTTCTAAAAAAGGAAAGG -3'

Posted On

2020-01-23