Incidental Mutation 'R8034:Npas3'
ID618143
Institutional Source Beutler Lab
Gene Symbol Npas3
Ensembl Gene ENSMUSG00000021010
Gene Nameneuronal PAS domain protein 3
Synonyms4930423H22Rik, bHLHe12
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location53248677-54072175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53640529 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 159 (I159N)
Ref Sequence ENSEMBL: ENSMUSP00000098975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]
Predicted Effect probably damaging
Transcript: ENSMUST00000101432
AA Change: I159N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: I159N

DomainStartEndE-ValueType
HLH 64 119 1.34e-6 SMART
PAS 154 220 8.69e-11 SMART
low complexity region 234 256 N/A INTRINSIC
PAS 326 392 7.4e-5 SMART
PAC 398 441 2.46e-1 SMART
low complexity region 461 477 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 598 627 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223057
AA Change: I141N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000223358
AA Change: I131N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Npas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Npas3 APN 12 54003560 missense probably damaging 1.00
IGL01330:Npas3 APN 12 54048819 missense probably damaging 1.00
IGL01376:Npas3 APN 12 54044586 missense probably benign 0.01
IGL01634:Npas3 APN 12 53947163 missense probably damaging 1.00
IGL02456:Npas3 APN 12 54048767 missense probably damaging 0.99
IGL02663:Npas3 APN 12 54068908 missense probably damaging 1.00
IGL02731:Npas3 APN 12 54067795 missense probably benign 0.01
IGL02955:Npas3 APN 12 53501265 missense probably damaging 0.96
IGL03001:Npas3 APN 12 53501192 missense probably damaging 1.00
IGL03047:Npas3 APN 12 53831687 splice site probably benign
ANU05:Npas3 UTSW 12 54068074 missense possibly damaging 0.49
IGL02837:Npas3 UTSW 12 53947197 missense possibly damaging 0.79
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0396:Npas3 UTSW 12 53831745 missense probably damaging 1.00
R1687:Npas3 UTSW 12 54048875 splice site probably null
R1863:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R2004:Npas3 UTSW 12 54067897 missense possibly damaging 0.63
R2047:Npas3 UTSW 12 54068829 missense probably damaging 0.99
R2049:Npas3 UTSW 12 54062088 missense probably damaging 1.00
R2278:Npas3 UTSW 12 53640502 missense possibly damaging 0.92
R2323:Npas3 UTSW 12 54068346 missense probably damaging 1.00
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R3116:Npas3 UTSW 12 54067725 splice site probably null
R3431:Npas3 UTSW 12 54069049 missense probably damaging 0.99
R3731:Npas3 UTSW 12 53354392 missense probably benign 0.11
R3767:Npas3 UTSW 12 54069074 makesense probably null
R4332:Npas3 UTSW 12 54062069 missense probably damaging 0.99
R4593:Npas3 UTSW 12 54068497 missense probably benign 0.08
R4601:Npas3 UTSW 12 54044578 missense probably damaging 0.99
R4654:Npas3 UTSW 12 54062132 critical splice donor site probably null
R4946:Npas3 UTSW 12 54065835 missense probably damaging 1.00
R5140:Npas3 UTSW 12 53501114 nonsense probably null
R5302:Npas3 UTSW 12 54068836 missense probably damaging 1.00
R5524:Npas3 UTSW 12 54068938 missense possibly damaging 0.64
R5735:Npas3 UTSW 12 54003479 missense probably benign 0.00
R6252:Npas3 UTSW 12 54068890 missense probably damaging 1.00
R6438:Npas3 UTSW 12 54068698 missense probably damaging 0.99
R6987:Npas3 UTSW 12 54068253 missense possibly damaging 0.94
R6994:Npas3 UTSW 12 54068793 missense probably damaging 0.96
R7304:Npas3 UTSW 12 54069041 missense probably damaging 1.00
R7684:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R7724:Npas3 UTSW 12 54068341 missense possibly damaging 0.90
R7739:Npas3 UTSW 12 54068718 missense probably damaging 1.00
R7826:Npas3 UTSW 12 53831756 missense possibly damaging 0.92
R8017:Npas3 UTSW 12 54044679 missense probably damaging 1.00
R8019:Npas3 UTSW 12 54044679 missense probably damaging 1.00
X0003:Npas3 UTSW 12 54044728 splice site probably null
X0064:Npas3 UTSW 12 53354384 missense probably damaging 0.96
Z1176:Npas3 UTSW 12 53501180 missense probably damaging 0.99
Z1177:Npas3 UTSW 12 53947206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACCAGCGTTTCTTTCAGAAC -3'
(R):5'- TCCCTCAAGGAATGGCTTTC -3'

Sequencing Primer
(F):5'- CAGAACTCATTGATGCTTTAGCGG -3'
(R):5'- TGGCTTTCTAAAAAAGGAAAGG -3'
Posted On2020-01-23