Incidental Mutation 'R8034:Npas3'
ID 618143
Institutional Source Beutler Lab
Gene Symbol Npas3
Ensembl Gene ENSMUSG00000021010
Gene Name neuronal PAS domain protein 3
Synonyms bHLHe12, 4930423H22Rik
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.924) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 53294940-54118958 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53687312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 159 (I159N)
Ref Sequence ENSEMBL: ENSMUSP00000098975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000101432
AA Change: I159N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: I159N

DomainStartEndE-ValueType
HLH 64 119 1.34e-6 SMART
PAS 154 220 8.69e-11 SMART
low complexity region 234 256 N/A INTRINSIC
PAS 326 392 7.4e-5 SMART
PAC 398 441 2.46e-1 SMART
low complexity region 461 477 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 598 627 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223057
AA Change: I141N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000223358
AA Change: I131N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
H2-Q10 A T 17: 35,781,338 (GRCm39) I47F probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lcn6 T A 2: 25,566,883 (GRCm39) L19* probably null Het
Lhcgr T C 17: 89,049,784 (GRCm39) T581A probably damaging Het
Map4k1 T C 7: 28,687,573 (GRCm39) I203T probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sec13 T C 6: 113,712,050 (GRCm39) K95R probably benign Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sema5a A G 15: 32,574,987 (GRCm39) Y365C probably damaging Het
Sp140l2 T A 1: 85,231,881 (GRCm39) T180S probably benign Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in Npas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Npas3 APN 12 54,050,343 (GRCm39) missense probably damaging 1.00
IGL01330:Npas3 APN 12 54,095,602 (GRCm39) missense probably damaging 1.00
IGL01376:Npas3 APN 12 54,091,369 (GRCm39) missense probably benign 0.01
IGL01634:Npas3 APN 12 53,993,946 (GRCm39) missense probably damaging 1.00
IGL02456:Npas3 APN 12 54,095,550 (GRCm39) missense probably damaging 0.99
IGL02663:Npas3 APN 12 54,115,691 (GRCm39) missense probably damaging 1.00
IGL02731:Npas3 APN 12 54,114,578 (GRCm39) missense probably benign 0.01
IGL02955:Npas3 APN 12 53,548,048 (GRCm39) missense probably damaging 0.96
IGL03001:Npas3 APN 12 53,547,975 (GRCm39) missense probably damaging 1.00
IGL03047:Npas3 APN 12 53,878,470 (GRCm39) splice site probably benign
ANU05:Npas3 UTSW 12 54,114,857 (GRCm39) missense possibly damaging 0.49
IGL02837:Npas3 UTSW 12 53,993,980 (GRCm39) missense possibly damaging 0.79
R0042:Npas3 UTSW 12 54,095,624 (GRCm39) missense probably damaging 1.00
R0042:Npas3 UTSW 12 54,095,624 (GRCm39) missense probably damaging 1.00
R0396:Npas3 UTSW 12 53,878,528 (GRCm39) missense probably damaging 1.00
R1687:Npas3 UTSW 12 54,095,658 (GRCm39) splice site probably null
R1863:Npas3 UTSW 12 54,115,609 (GRCm39) missense probably damaging 1.00
R2004:Npas3 UTSW 12 54,114,680 (GRCm39) missense possibly damaging 0.63
R2047:Npas3 UTSW 12 54,115,612 (GRCm39) missense probably damaging 0.99
R2049:Npas3 UTSW 12 54,108,871 (GRCm39) missense probably damaging 1.00
R2278:Npas3 UTSW 12 53,687,285 (GRCm39) missense possibly damaging 0.92
R2323:Npas3 UTSW 12 54,115,129 (GRCm39) missense probably damaging 1.00
R2871:Npas3 UTSW 12 54,114,796 (GRCm39) nonsense probably null
R2871:Npas3 UTSW 12 54,114,796 (GRCm39) nonsense probably null
R3116:Npas3 UTSW 12 54,114,508 (GRCm39) splice site probably null
R3431:Npas3 UTSW 12 54,115,832 (GRCm39) missense probably damaging 0.99
R3731:Npas3 UTSW 12 53,401,175 (GRCm39) missense probably benign 0.11
R3767:Npas3 UTSW 12 54,115,857 (GRCm39) makesense probably null
R4332:Npas3 UTSW 12 54,108,852 (GRCm39) missense probably damaging 0.99
R4593:Npas3 UTSW 12 54,115,280 (GRCm39) missense probably benign 0.08
R4601:Npas3 UTSW 12 54,091,361 (GRCm39) missense probably damaging 0.99
R4654:Npas3 UTSW 12 54,108,915 (GRCm39) critical splice donor site probably null
R4946:Npas3 UTSW 12 54,112,618 (GRCm39) missense probably damaging 1.00
R5140:Npas3 UTSW 12 53,547,897 (GRCm39) nonsense probably null
R5302:Npas3 UTSW 12 54,115,619 (GRCm39) missense probably damaging 1.00
R5524:Npas3 UTSW 12 54,115,721 (GRCm39) missense possibly damaging 0.64
R5735:Npas3 UTSW 12 54,050,262 (GRCm39) missense probably benign 0.00
R6252:Npas3 UTSW 12 54,115,673 (GRCm39) missense probably damaging 1.00
R6438:Npas3 UTSW 12 54,115,481 (GRCm39) missense probably damaging 0.99
R6987:Npas3 UTSW 12 54,115,036 (GRCm39) missense possibly damaging 0.94
R6994:Npas3 UTSW 12 54,115,576 (GRCm39) missense probably damaging 0.96
R7304:Npas3 UTSW 12 54,115,824 (GRCm39) missense probably damaging 1.00
R7684:Npas3 UTSW 12 54,115,609 (GRCm39) missense probably damaging 1.00
R7724:Npas3 UTSW 12 54,115,124 (GRCm39) missense possibly damaging 0.90
R7739:Npas3 UTSW 12 54,115,501 (GRCm39) missense probably damaging 1.00
R7826:Npas3 UTSW 12 53,878,539 (GRCm39) missense possibly damaging 0.92
R8017:Npas3 UTSW 12 54,091,462 (GRCm39) missense probably damaging 1.00
R8019:Npas3 UTSW 12 54,091,462 (GRCm39) missense probably damaging 1.00
R8422:Npas3 UTSW 12 54,115,292 (GRCm39) missense probably benign
R9172:Npas3 UTSW 12 54,112,653 (GRCm39) missense probably benign 0.08
R9207:Npas3 UTSW 12 54,114,818 (GRCm39) missense possibly damaging 0.87
R9774:Npas3 UTSW 12 53,994,108 (GRCm39) missense probably damaging 1.00
X0003:Npas3 UTSW 12 54,091,511 (GRCm39) splice site probably null
X0064:Npas3 UTSW 12 53,401,167 (GRCm39) missense probably damaging 0.96
Z1176:Npas3 UTSW 12 53,547,963 (GRCm39) missense probably damaging 0.99
Z1177:Npas3 UTSW 12 53,993,989 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACCAGCGTTTCTTTCAGAAC -3'
(R):5'- TCCCTCAAGGAATGGCTTTC -3'

Sequencing Primer
(F):5'- CAGAACTCATTGATGCTTTAGCGG -3'
(R):5'- TGGCTTTCTAAAAAAGGAAAGG -3'
Posted On 2020-01-23