Incidental Mutation 'R8034:Mctp1'
ID618144
Institutional Source Beutler Lab
Gene Symbol Mctp1
Ensembl Gene ENSMUSG00000021596
Gene Namemultiple C2 domains, transmembrane 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location76384535-77031810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 76891551 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 783 (L783F)
Ref Sequence ENSEMBL: ENSMUSP00000118958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109583] [ENSMUST00000125209]
Predicted Effect probably damaging
Transcript: ENSMUST00000109583
AA Change: L526F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105212
Gene: ENSMUSG00000021596
AA Change: L526F

DomainStartEndE-ValueType
C2 3 100 1.15e-15 SMART
C2 166 263 1.35e-21 SMART
C2 322 418 4.76e-22 SMART
transmembrane domain 513 535 N/A INTRINSIC
Pfam:PRT_C 542 672 3.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125209
AA Change: L783F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118958
Gene: ENSMUSG00000021596
AA Change: L783F

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 134 174 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
C2 260 357 1.15e-15 SMART
C2 423 520 1.35e-21 SMART
C2 579 675 4.76e-22 SMART
transmembrane domain 770 792 N/A INTRINSIC
Pfam:PRT_C 800 929 2.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Mctp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mctp1 APN 13 77020798 missense probably damaging 0.98
IGL01355:Mctp1 APN 13 76384955 missense probably benign
IGL02192:Mctp1 APN 13 76731768 intron probably benign
IGL02342:Mctp1 APN 13 77024857 missense probably damaging 1.00
IGL02706:Mctp1 APN 13 76823069 missense probably damaging 1.00
IGL02950:Mctp1 APN 13 77024810 missense probably damaging 1.00
IGL03064:Mctp1 APN 13 76801513 nonsense probably null
IGL03230:Mctp1 APN 13 76824857 missense possibly damaging 0.49
R0138:Mctp1 UTSW 13 76827712 missense probably damaging 1.00
R0355:Mctp1 UTSW 13 76824863 missense probably damaging 1.00
R0383:Mctp1 UTSW 13 76801544 missense probably damaging 1.00
R0426:Mctp1 UTSW 13 77020821 missense probably benign 0.01
R0462:Mctp1 UTSW 13 76801401 missense probably damaging 1.00
R0483:Mctp1 UTSW 13 76827727 missense probably damaging 1.00
R0685:Mctp1 UTSW 13 76825799 critical splice donor site probably null
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1854:Mctp1 UTSW 13 76825741 missense probably damaging 0.96
R1864:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1865:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1920:Mctp1 UTSW 13 76384610 missense possibly damaging 0.67
R2071:Mctp1 UTSW 13 76759724 missense probably damaging 1.00
R2127:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2128:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2129:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R3709:Mctp1 UTSW 13 76824880 splice site probably null
R4463:Mctp1 UTSW 13 76712087 missense probably damaging 1.00
R4510:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4511:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4951:Mctp1 UTSW 13 76827775 missense probably damaging 0.96
R5004:Mctp1 UTSW 13 76641804 missense possibly damaging 0.79
R5307:Mctp1 UTSW 13 76712079 critical splice acceptor site probably null
R5339:Mctp1 UTSW 13 76825706 intron probably benign
R5639:Mctp1 UTSW 13 77024783 splice site silent
R5769:Mctp1 UTSW 13 76759808 missense probably damaging 1.00
R5800:Mctp1 UTSW 13 76688559 missense probably damaging 1.00
R5913:Mctp1 UTSW 13 76759825 splice site probably null
R5981:Mctp1 UTSW 13 76757110 missense probably damaging 1.00
R6024:Mctp1 UTSW 13 76385161 missense probably damaging 0.98
R6192:Mctp1 UTSW 13 76822963 splice site probably null
R6331:Mctp1 UTSW 13 77020863 critical splice donor site probably null
R6468:Mctp1 UTSW 13 76731811 critical splice donor site probably null
R6484:Mctp1 UTSW 13 76688625 missense probably benign 0.02
R6656:Mctp1 UTSW 13 77029936 missense probably damaging 0.99
R7026:Mctp1 UTSW 13 76806259 missense probably benign 0.35
R7482:Mctp1 UTSW 13 76741460 intron probably null
R7890:Mctp1 UTSW 13 76827757 missense probably damaging 1.00
R7973:Mctp1 UTSW 13 76827757 missense probably damaging 1.00
R8029:Mctp1 UTSW 13 77029886 missense probably damaging 1.00
R8085:Mctp1 UTSW 13 76824853 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCCAGTGACTTTCCAGGAG -3'
(R):5'- CTCCAAAGTTGAATATTGACAGGC -3'

Sequencing Primer
(F):5'- ACTTTCCAGGAGTCAGATGTGC -3'
(R):5'- ACAGGCAAGTTTCTGGTTTATAAGGC -3'
Posted On2020-01-23