Mutagenetix > Incidental Mutation

Incidental Mutation 'R8034:Sema5a'

618147

Institutional Source

Beutler Lab

Gene Symbol

Sema5a

Ensembl Gene

ENSMUSG00000022231

Gene Name

sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A

Synonyms

semF, 9130201M22Rik, Semaf, M-Sema D

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32244810-32696341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32574841 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 365 (Y365C)

Ref Sequence

ENSEMBL: ENSMUSP00000069024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000067458
AA Change: Y365C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: Y365C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Sema	58	468	2.18e-173	SMART
PSI	486	533	1.78e-9	SMART
TSP1	543	597	2.23e-1	SMART
TSP1	598	651	2.05e-15	SMART
TSP1	656	702	6.94e-13	SMART
low complexity region	707	715	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
TSP1	787	839	4.17e-16	SMART
TSP1	844	896	9.08e-17	SMART
TSP1	899	946	3.19e-3	SMART
low complexity region	949	960	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227976

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228442

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Sema5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Sema5a	APN	15	32618880	missense	probably benign	0.06
IGL01148:Sema5a	APN	15	32681495	missense	probably benign	0.00
IGL01285:Sema5a	APN	15	32574997	missense	possibly damaging	0.66
IGL01647:Sema5a	APN	15	32417441	missense	possibly damaging	0.82
IGL01845:Sema5a	APN	15	32474368	splice site	probably benign
IGL01970:Sema5a	APN	15	32686646	missense	probably benign	0.02
IGL01986:Sema5a	APN	15	32682360	splice site	probably benign
IGL02053:Sema5a	APN	15	32550267	missense	probably benign	0.00
IGL02234:Sema5a	APN	15	32679172	missense	probably damaging	1.00
IGL02325:Sema5a	APN	15	32686831	missense	possibly damaging	0.63
IGL02370:Sema5a	APN	15	32682299	splice site	probably benign
IGL02427:Sema5a	APN	15	32673544	splice site	probably benign
IGL02621:Sema5a	APN	15	32538656	splice site	probably benign
IGL02656:Sema5a	APN	15	32631285	missense	possibly damaging	0.95
IGL03091:Sema5a	APN	15	32538734	splice site	probably benign
IGL03107:Sema5a	APN	15	32669408	missense	probably damaging	0.98
IGL03114:Sema5a	APN	15	32673427	missense	probably damaging	0.99
IGL03222:Sema5a	APN	15	32628158	missense	probably benign	0.32
PIT4305001:Sema5a	UTSW	15	32628199	missense	probably benign
R0190:Sema5a	UTSW	15	32562774	missense	possibly damaging	0.93
R0409:Sema5a	UTSW	15	32681609	missense	probably damaging	1.00
R0413:Sema5a	UTSW	15	32669444	missense	probably damaging	1.00
R0504:Sema5a	UTSW	15	32574803	splice site	probably benign
R1235:Sema5a	UTSW	15	32609226	missense	probably benign	0.04
R1484:Sema5a	UTSW	15	32460285	missense	probably damaging	1.00
R1550:Sema5a	UTSW	15	32618849	missense	probably benign	0.00
R1557:Sema5a	UTSW	15	32460272	missense	probably benign	0.04
R1670:Sema5a	UTSW	15	32548799	missense	probably damaging	1.00
R1688:Sema5a	UTSW	15	32669424	missense	probably benign	0.01
R1760:Sema5a	UTSW	15	32641106	missense	probably damaging	0.99
R1960:Sema5a	UTSW	15	32562731	missense	possibly damaging	0.66
R1967:Sema5a	UTSW	15	32681619	missense	probably damaging	0.99
R2062:Sema5a	UTSW	15	32609217	splice site	probably benign
R2082:Sema5a	UTSW	15	32618856	missense	probably benign	0.04
R2218:Sema5a	UTSW	15	32631309	missense	probably damaging	0.99
R2267:Sema5a	UTSW	15	32574919	missense	probably benign	0.03
R2299:Sema5a	UTSW	15	32562776	missense	possibly damaging	0.95
R2438:Sema5a	UTSW	15	32550253	missense	possibly damaging	0.63
R2698:Sema5a	UTSW	15	32673400	missense	probably damaging	1.00
R3950:Sema5a	UTSW	15	32689338	missense	probably damaging	1.00
R4197:Sema5a	UTSW	15	32618918	missense	probably benign
R4496:Sema5a	UTSW	15	32640987	missense	probably damaging	1.00
R4840:Sema5a	UTSW	15	32550254	missense	possibly damaging	0.63
R4842:Sema5a	UTSW	15	32609417	missense	probably benign
R4867:Sema5a	UTSW	15	32550290	missense	possibly damaging	0.60
R4934:Sema5a	UTSW	15	32679164	missense	probably damaging	1.00
R4977:Sema5a	UTSW	15	32679186	missense	probably damaging	1.00
R5204:Sema5a	UTSW	15	32686647	missense	probably benign	0.00
R5580:Sema5a	UTSW	15	32574885	missense	probably benign	0.00
R5937:Sema5a	UTSW	15	32574841	missense	probably damaging	1.00
R6220:Sema5a	UTSW	15	32686729	missense	probably damaging	0.99
R6897:Sema5a	UTSW	15	32550275	missense	probably benign	0.05
R7037:Sema5a	UTSW	15	32686847	missense	probably damaging	1.00
R7072:Sema5a	UTSW	15	32574959	missense	possibly damaging	0.94
R7273:Sema5a	UTSW	15	32417462	missense	probably benign
R7572:Sema5a	UTSW	15	32673428	missense	probably damaging	1.00
R7621:Sema5a	UTSW	15	32609232	missense	possibly damaging	0.65
R7642:Sema5a	UTSW	15	32682325	missense	probably damaging	0.97
R7870:Sema5a	UTSW	15	32609339	missense	probably benign	0.23
R7880:Sema5a	UTSW	15	32686808	missense	probably damaging	1.00
R8025:Sema5a	UTSW	15	32548782	missense	probably benign	0.37
R8241:Sema5a	UTSW	15	32574918	missense	probably benign
R8539:Sema5a	UTSW	15	32618843	missense	probably damaging	0.98
R8728:Sema5a	UTSW	15	32562557	missense	probably damaging	0.98
R8807:Sema5a	UTSW	15	32562722	missense	possibly damaging	0.83
R8825:Sema5a	UTSW	15	32689352	missense	probably benign	0.02
R9109:Sema5a	UTSW	15	32618894	missense	probably benign	0.02
R9235:Sema5a	UTSW	15	32618888	missense	probably benign	0.01
R9298:Sema5a	UTSW	15	32618894	missense	probably benign	0.02
R9354:Sema5a	UTSW	15	32562756	nonsense	probably null
R9515:Sema5a	UTSW	15	32679227	missense	probably damaging	1.00
R9663:Sema5a	UTSW	15	32673400	nonsense	probably null
X0020:Sema5a	UTSW	15	32417500	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCATCCACAGTGGGAGAACAG -3'
(R):5'- AGCACGAGTTCCTACCTGTG -3'

Sequencing Primer
(F):5'- TGCCAGTCGAGGGAGATG -3'
(R):5'- CCTACCTGTGGCCAGATAAATGATG -3'

Posted On

2020-01-23