Incidental Mutation 'R8034:Sema5a'
ID 618147
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Name sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms M-Sema D, semF, Semaf, 9130201M22Rik
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 32244959-32696487 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32574987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 365 (Y365C)
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067458
AA Change: Y365C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: Y365C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228442
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
H2-Q10 A T 17: 35,781,338 (GRCm39) I47F probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lcn6 T A 2: 25,566,883 (GRCm39) L19* probably null Het
Lhcgr T C 17: 89,049,784 (GRCm39) T581A probably damaging Het
Map4k1 T C 7: 28,687,573 (GRCm39) I203T probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Npas3 T A 12: 53,687,312 (GRCm39) I159N probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sec13 T C 6: 113,712,050 (GRCm39) K95R probably benign Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sp140l2 T A 1: 85,231,881 (GRCm39) T180S probably benign Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32,619,026 (GRCm39) missense probably benign 0.06
IGL01148:Sema5a APN 15 32,681,641 (GRCm39) missense probably benign 0.00
IGL01285:Sema5a APN 15 32,575,143 (GRCm39) missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32,417,587 (GRCm39) missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32,474,514 (GRCm39) splice site probably benign
IGL01970:Sema5a APN 15 32,686,792 (GRCm39) missense probably benign 0.02
IGL01986:Sema5a APN 15 32,682,506 (GRCm39) splice site probably benign
IGL02053:Sema5a APN 15 32,550,413 (GRCm39) missense probably benign 0.00
IGL02234:Sema5a APN 15 32,679,318 (GRCm39) missense probably damaging 1.00
IGL02325:Sema5a APN 15 32,686,977 (GRCm39) missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32,682,445 (GRCm39) splice site probably benign
IGL02427:Sema5a APN 15 32,673,690 (GRCm39) splice site probably benign
IGL02621:Sema5a APN 15 32,538,802 (GRCm39) splice site probably benign
IGL02656:Sema5a APN 15 32,631,431 (GRCm39) missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32,538,880 (GRCm39) splice site probably benign
IGL03107:Sema5a APN 15 32,669,554 (GRCm39) missense probably damaging 0.98
IGL03114:Sema5a APN 15 32,673,573 (GRCm39) missense probably damaging 0.99
IGL03222:Sema5a APN 15 32,628,304 (GRCm39) missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32,628,345 (GRCm39) missense probably benign
R0190:Sema5a UTSW 15 32,562,920 (GRCm39) missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32,681,755 (GRCm39) missense probably damaging 1.00
R0413:Sema5a UTSW 15 32,669,590 (GRCm39) missense probably damaging 1.00
R0504:Sema5a UTSW 15 32,574,949 (GRCm39) splice site probably benign
R1235:Sema5a UTSW 15 32,609,372 (GRCm39) missense probably benign 0.04
R1484:Sema5a UTSW 15 32,460,431 (GRCm39) missense probably damaging 1.00
R1550:Sema5a UTSW 15 32,618,995 (GRCm39) missense probably benign 0.00
R1557:Sema5a UTSW 15 32,460,418 (GRCm39) missense probably benign 0.04
R1670:Sema5a UTSW 15 32,548,945 (GRCm39) missense probably damaging 1.00
R1688:Sema5a UTSW 15 32,669,570 (GRCm39) missense probably benign 0.01
R1760:Sema5a UTSW 15 32,641,252 (GRCm39) missense probably damaging 0.99
R1960:Sema5a UTSW 15 32,562,877 (GRCm39) missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32,681,765 (GRCm39) missense probably damaging 0.99
R2062:Sema5a UTSW 15 32,609,363 (GRCm39) splice site probably benign
R2082:Sema5a UTSW 15 32,619,002 (GRCm39) missense probably benign 0.04
R2218:Sema5a UTSW 15 32,631,455 (GRCm39) missense probably damaging 0.99
R2267:Sema5a UTSW 15 32,575,065 (GRCm39) missense probably benign 0.03
R2299:Sema5a UTSW 15 32,562,922 (GRCm39) missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32,550,399 (GRCm39) missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32,673,546 (GRCm39) missense probably damaging 1.00
R3950:Sema5a UTSW 15 32,689,484 (GRCm39) missense probably damaging 1.00
R4197:Sema5a UTSW 15 32,619,064 (GRCm39) missense probably benign
R4496:Sema5a UTSW 15 32,641,133 (GRCm39) missense probably damaging 1.00
R4840:Sema5a UTSW 15 32,550,400 (GRCm39) missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32,609,563 (GRCm39) missense probably benign
R4867:Sema5a UTSW 15 32,550,436 (GRCm39) missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32,679,310 (GRCm39) missense probably damaging 1.00
R4977:Sema5a UTSW 15 32,679,332 (GRCm39) missense probably damaging 1.00
R5204:Sema5a UTSW 15 32,686,793 (GRCm39) missense probably benign 0.00
R5580:Sema5a UTSW 15 32,575,031 (GRCm39) missense probably benign 0.00
R5937:Sema5a UTSW 15 32,574,987 (GRCm39) missense probably damaging 1.00
R6220:Sema5a UTSW 15 32,686,875 (GRCm39) missense probably damaging 0.99
R6897:Sema5a UTSW 15 32,550,421 (GRCm39) missense probably benign 0.05
R7037:Sema5a UTSW 15 32,686,993 (GRCm39) missense probably damaging 1.00
R7072:Sema5a UTSW 15 32,575,105 (GRCm39) missense possibly damaging 0.94
R7273:Sema5a UTSW 15 32,417,608 (GRCm39) missense probably benign
R7572:Sema5a UTSW 15 32,673,574 (GRCm39) missense probably damaging 1.00
R7621:Sema5a UTSW 15 32,609,378 (GRCm39) missense possibly damaging 0.65
R7642:Sema5a UTSW 15 32,682,471 (GRCm39) missense probably damaging 0.97
R7870:Sema5a UTSW 15 32,609,485 (GRCm39) missense probably benign 0.23
R7880:Sema5a UTSW 15 32,686,954 (GRCm39) missense probably damaging 1.00
R8025:Sema5a UTSW 15 32,548,928 (GRCm39) missense probably benign 0.37
R8241:Sema5a UTSW 15 32,575,064 (GRCm39) missense probably benign
R8539:Sema5a UTSW 15 32,618,989 (GRCm39) missense probably damaging 0.98
R8728:Sema5a UTSW 15 32,562,703 (GRCm39) missense probably damaging 0.98
R8807:Sema5a UTSW 15 32,562,868 (GRCm39) missense possibly damaging 0.83
R8825:Sema5a UTSW 15 32,689,498 (GRCm39) missense probably benign 0.02
R9109:Sema5a UTSW 15 32,619,040 (GRCm39) missense probably benign 0.02
R9235:Sema5a UTSW 15 32,619,034 (GRCm39) missense probably benign 0.01
R9298:Sema5a UTSW 15 32,619,040 (GRCm39) missense probably benign 0.02
R9354:Sema5a UTSW 15 32,562,902 (GRCm39) nonsense probably null
R9515:Sema5a UTSW 15 32,679,373 (GRCm39) missense probably damaging 1.00
R9663:Sema5a UTSW 15 32,673,546 (GRCm39) nonsense probably null
X0020:Sema5a UTSW 15 32,417,646 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCATCCACAGTGGGAGAACAG -3'
(R):5'- AGCACGAGTTCCTACCTGTG -3'

Sequencing Primer
(F):5'- TGCCAGTCGAGGGAGATG -3'
(R):5'- CCTACCTGTGGCCAGATAAATGATG -3'
Posted On 2020-01-23