Incidental Mutation 'R8034:Eif3e'
ID 618148
Institutional Source Beutler Lab
Gene Symbol Eif3e
Ensembl Gene ENSMUSG00000022336
Gene Name eukaryotic translation initiation factor 3, subunit E
Synonyms Eif3s6, eIF3-p46, 48kDa, Int6, eIF3-p48
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 43250058-43282719 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43272307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 112 (M112K)
Ref Sequence ENSEMBL: ENSMUSP00000022960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022960]
AlphaFold P60229
Predicted Effect probably benign
Transcript: ENSMUST00000022960
AA Change: M112K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022960
Gene: ENSMUSG00000022336
AA Change: M112K

DomainStartEndE-ValueType
eIF3_N 5 138 4.88e-70 SMART
Blast:eIF3_N 157 193 2e-14 BLAST
Blast:PINT 218 251 7e-9 BLAST
Blast:PINT 284 315 3e-13 BLAST
PINT 327 411 8.17e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Eif3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Eif3e APN 15 43278349 missense probably benign 0.17
IGL02333:Eif3e APN 15 43266137 missense probably benign 0.37
IGL02669:Eif3e APN 15 43282692 start codon destroyed probably benign
IGL03119:Eif3e APN 15 43265604 missense probably benign
IGL03200:Eif3e APN 15 43252261 missense probably damaging 1.00
Verdugo UTSW 15 43272289 missense probably benign 0.29
R0152:Eif3e UTSW 15 43252236 missense possibly damaging 0.83
R1439:Eif3e UTSW 15 43278428 splice site probably benign
R1613:Eif3e UTSW 15 43250224 missense possibly damaging 0.81
R1997:Eif3e UTSW 15 43265609 missense probably damaging 1.00
R2221:Eif3e UTSW 15 43251547 missense possibly damaging 0.95
R3761:Eif3e UTSW 15 43261084 missense probably damaging 0.99
R4241:Eif3e UTSW 15 43262690 missense probably damaging 0.97
R4571:Eif3e UTSW 15 43266162 missense possibly damaging 0.74
R5061:Eif3e UTSW 15 43252261 missense probably damaging 1.00
R5227:Eif3e UTSW 15 43251521 missense probably benign 0.01
R5367:Eif3e UTSW 15 43252304 missense probably damaging 1.00
R5417:Eif3e UTSW 15 43265521 missense probably benign 0.00
R5497:Eif3e UTSW 15 43270970 missense probably damaging 0.98
R5928:Eif3e UTSW 15 43275332 splice site probably null
R6083:Eif3e UTSW 15 43266144 missense probably damaging 1.00
R6337:Eif3e UTSW 15 43252296 missense possibly damaging 0.95
R6964:Eif3e UTSW 15 43272289 missense probably benign 0.29
R7692:Eif3e UTSW 15 43263246 missense probably damaging 0.98
R7825:Eif3e UTSW 15 43266271 splice site probably null
R9463:Eif3e UTSW 15 43275313 missense probably benign
R9583:Eif3e UTSW 15 43265561 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATTATGAGATATCACGGCTGAGG -3'
(R):5'- ACTTTGTGACGGGCATCTTC -3'

Sequencing Primer
(F):5'- GCACAGCATTAGTCTCTAATG -3'
(R):5'- ACGGGCATCTTCTAAATTTGGTC -3'
Posted On 2020-01-23