Incidental Mutation 'R8034:Chmp2b'
ID618150
Institutional Source Beutler Lab
Gene Symbol Chmp2b
Ensembl Gene ENSMUSG00000004843
Gene Namecharged multivesicular body protein 2B
Synonymschromatin modifying protein 2B, 1190006E07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location65539128-65562726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65546883 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 96 (M96K)
Ref Sequence ENSEMBL: ENSMUSP00000004965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004965] [ENSMUST00000231259]
Predicted Effect probably benign
Transcript: ENSMUST00000004965
AA Change: M96K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004965
Gene: ENSMUSG00000004843
AA Change: M96K

DomainStartEndE-ValueType
Pfam:Snf7 16 186 1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231259
AA Change: M92K

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) that functions in the recycling or degradation of cell surface receptors. ESCRT-III functions in the concentration and invagination of ubiquitinated endosomal cargos into intralumenal vesicles. The protein encoded by this gene is found as a monomer in the cytosol or as an oligomer in ESCRT-III complexes on endosomal membranes. It is expressed in neurons of all major regions of the brain. Mutations in this gene result in one form of familial frontotemporal lobar degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic gene trapped allele display reduced dendritic spine and excitatory synapse density in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Chmp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Chmp2b APN 16 65562477 missense probably benign 0.01
IGL01807:Chmp2b APN 16 65540205 missense probably benign
R0256:Chmp2b UTSW 16 65540192 missense probably benign 0.18
R1688:Chmp2b UTSW 16 65551036 missense probably benign 0.00
R1923:Chmp2b UTSW 16 65545327 missense possibly damaging 0.56
R2155:Chmp2b UTSW 16 65546991 missense probably benign 0.09
R4845:Chmp2b UTSW 16 65550976 missense probably damaging 0.99
R5559:Chmp2b UTSW 16 65540430 missense probably damaging 1.00
R6333:Chmp2b UTSW 16 65540250 missense possibly damaging 0.75
R6473:Chmp2b UTSW 16 65546872 missense probably damaging 1.00
R7142:Chmp2b UTSW 16 65546908 nonsense probably null
R7339:Chmp2b UTSW 16 65545346 nonsense probably null
R7761:Chmp2b UTSW 16 65546859 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGGAATGTCCTTTTAACACCCC -3'
(R):5'- AGATACTCTCTGATGACTGCCC -3'

Sequencing Primer
(F):5'- GCTAGATGCACAATTACTTGGATTG -3'
(R):5'- GATGACTGCCCCTTGATTTTATTTC -3'
Posted On2020-01-23