Incidental Mutation 'R8034:Ccnf'
ID618151
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Namecyclin F
SynonymsFbxo1, CycF
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24223232-24251409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24231831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 391 (V391A)
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
Predicted Effect probably damaging
Transcript: ENSMUST00000115390
AA Change: V391A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: V391A

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24225012 missense probably damaging 1.00
IGL01942:Ccnf APN 17 24242320 missense probably benign 0.03
IGL02251:Ccnf APN 17 24226539 missense probably benign 0.00
IGL02945:Ccnf APN 17 24224916 missense probably damaging 0.99
IGL02952:Ccnf APN 17 24231325 missense possibly damaging 0.93
albuquerque UTSW 17 24223997 nonsense probably null
R0326:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24226777 missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24223997 nonsense probably null
R1072:Ccnf UTSW 17 24237162 missense probably damaging 0.97
R1693:Ccnf UTSW 17 24226540 frame shift probably null
R2147:Ccnf UTSW 17 24230314 critical splice donor site probably null
R3929:Ccnf UTSW 17 24234382 missense probably damaging 1.00
R4081:Ccnf UTSW 17 24223898 makesense probably null
R4260:Ccnf UTSW 17 24226767 missense probably damaging 1.00
R4579:Ccnf UTSW 17 24231329 nonsense probably null
R4651:Ccnf UTSW 17 24231786 missense probably damaging 1.00
R4844:Ccnf UTSW 17 24230357 nonsense probably null
R4876:Ccnf UTSW 17 24230337 missense probably damaging 1.00
R5234:Ccnf UTSW 17 24234437 nonsense probably null
R5352:Ccnf UTSW 17 24243273 splice site probably null
R5845:Ccnf UTSW 17 24240793 missense possibly damaging 0.95
R6084:Ccnf UTSW 17 24231837 missense probably damaging 1.00
R6219:Ccnf UTSW 17 24226704 nonsense probably null
R7021:Ccnf UTSW 17 24242231 missense probably damaging 1.00
R7176:Ccnf UTSW 17 24249402 missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24223915 missense probably benign 0.00
R7485:Ccnf UTSW 17 24249258 missense probably damaging 0.97
R7763:Ccnf UTSW 17 24225012 missense probably damaging 1.00
R8016:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R8069:Ccnf UTSW 17 24225015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCTTTCTCCACAGCAG -3'
(R):5'- AGAAGCAAGTGGATTCGCTC -3'

Sequencing Primer
(F):5'- AGTAGCGCTCAATGGCCTCAG -3'
(R):5'- CTTTTGCCACCTGAGTCTGGAG -3'
Posted On2020-01-23