Incidental Mutation 'R8034:Tead3'
ID618152
Institutional Source Beutler Lab
Gene Symbol Tead3
Ensembl Gene ENSMUSG00000002249
Gene NameTEA domain family member 3
SynonymsDTEF-1, TEF-5, Tcf13r2, ETFR-1, TEAD-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28331671-28350805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 28333229 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 365 (V365G)
Ref Sequence ENSEMBL: ENSMUSP00000110447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042334] [ENSMUST00000114799] [ENSMUST00000129935] [ENSMUST00000154873] [ENSMUST00000156862] [ENSMUST00000219703]
Predicted Effect probably benign
Transcript: ENSMUST00000042334
SMART Domains Protein: ENSMUSP00000048469
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 12 213 3.5e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114799
AA Change: V365G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249
AA Change: V365G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129935
SMART Domains Protein: ENSMUSP00000114141
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 3 57 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154873
AA Change: V274G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249
AA Change: V274G

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156862
AA Change: V274G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249
AA Change: V274G

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219703
AA Change: V339G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and thought to play a role in placental gene regulation and development. Alternative splicing, and alternate use of an upstream AUG translation initiation codon, and an in-frame downstream non-AUG (AUA) codon, results in 2 isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Tead3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Tead3 APN 17 28332806 missense possibly damaging 0.91
IGL01752:Tead3 APN 17 28333594 missense probably damaging 1.00
IGL01760:Tead3 APN 17 28333081 missense probably benign 0.07
IGL02868:Tead3 APN 17 28333095 nonsense probably null
IGL02932:Tead3 APN 17 28341351 missense probably damaging 1.00
R0015:Tead3 UTSW 17 28341351 missense probably damaging 1.00
R0376:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R0383:Tead3 UTSW 17 28334698 splice site probably null
R1203:Tead3 UTSW 17 28341562 missense probably benign 0.06
R1699:Tead3 UTSW 17 28334724 missense possibly damaging 0.52
R2037:Tead3 UTSW 17 28336570 missense probably damaging 0.98
R2148:Tead3 UTSW 17 28333664 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28333615 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28334988 missense probably benign 0.42
R5070:Tead3 UTSW 17 28341477 missense probably benign 0.06
R5557:Tead3 UTSW 17 28336270 intron probably benign
R5891:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R5991:Tead3 UTSW 17 28334378 splice site probably null
R6335:Tead3 UTSW 17 28333325 missense probably damaging 1.00
R6999:Tead3 UTSW 17 28341532 missense probably benign 0.00
R7165:Tead3 UTSW 17 28333254 missense probably benign 0.00
R7718:Tead3 UTSW 17 28333517 missense probably damaging 1.00
R7743:Tead3 UTSW 17 28332827 missense probably benign 0.06
R8025:Tead3 UTSW 17 28335035 missense probably benign 0.23
X0066:Tead3 UTSW 17 28341427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGCAGATGCTTCAGTTTG -3'
(R):5'- TGGGTGAGGCCTCTTCTAAC -3'

Sequencing Primer
(F):5'- GGATGAAATTGATCATGTACTCGCAC -3'
(R):5'- GAGGCCTCTTCTAACCCCAGATG -3'
Posted On2020-01-23