Incidental Mutation 'R8034:H2-Q10'
ID 618153
Institutional Source Beutler Lab
Gene Symbol H2-Q10
Ensembl Gene ENSMUSG00000067235
Gene Name histocompatibility 2, Q region locus 10
Synonyms H-2Q10, Q10, Qa10
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 35780986-35785460 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35781338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000066419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068291] [ENSMUST00000174525]
AlphaFold P01898
Predicted Effect probably damaging
Transcript: ENSMUST00000068291
AA Change: I47F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066419
Gene: ENSMUSG00000067235
AA Change: I47F

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.8e-98 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174525
AA Change: I47F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134163
Gene: ENSMUSG00000067235
AA Change: I47F

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 3.3e-99 PFAM
IGc1 222 293 8.23e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Unlike other class I genes, this gene is expressed only in liver cells and its product is secreted into the serum. The amount of protein in serum varies among inbred strains with different H2 haplotypes and is completely absent in the H2f strain B10.M. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lcn6 T A 2: 25,566,883 (GRCm39) L19* probably null Het
Lhcgr T C 17: 89,049,784 (GRCm39) T581A probably damaging Het
Map4k1 T C 7: 28,687,573 (GRCm39) I203T probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Npas3 T A 12: 53,687,312 (GRCm39) I159N probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sec13 T C 6: 113,712,050 (GRCm39) K95R probably benign Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sema5a A G 15: 32,574,987 (GRCm39) Y365C probably damaging Het
Sp140l2 T A 1: 85,231,881 (GRCm39) T180S probably benign Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in H2-Q10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:H2-Q10 APN 17 35,784,168 (GRCm39) missense probably damaging 1.00
IGL02003:H2-Q10 APN 17 35,781,338 (GRCm39) missense probably benign 0.01
IGL02308:H2-Q10 APN 17 35,784,463 (GRCm39) makesense probably null
IGL02804:H2-Q10 APN 17 35,784,147 (GRCm39) missense probably damaging 1.00
gomez UTSW 17 35,784,917 (GRCm39) utr 3 prime probably benign
lurch UTSW 17 35,781,915 (GRCm39) missense possibly damaging 0.92
R0278:H2-Q10 UTSW 17 35,784,204 (GRCm39) missense possibly damaging 0.83
R1679:H2-Q10 UTSW 17 35,784,492 (GRCm39) utr 3 prime probably benign
R1919:H2-Q10 UTSW 17 35,781,385 (GRCm39) missense probably damaging 1.00
R3781:H2-Q10 UTSW 17 35,781,915 (GRCm39) missense possibly damaging 0.92
R3782:H2-Q10 UTSW 17 35,781,915 (GRCm39) missense possibly damaging 0.92
R4614:H2-Q10 UTSW 17 35,784,917 (GRCm39) utr 3 prime probably benign
R4814:H2-Q10 UTSW 17 35,784,481 (GRCm39) utr 3 prime probably benign
R4870:H2-Q10 UTSW 17 35,781,357 (GRCm39) missense probably damaging 1.00
R6063:H2-Q10 UTSW 17 35,781,026 (GRCm39) missense probably benign 0.13
R7448:H2-Q10 UTSW 17 35,784,457 (GRCm39) missense not run
R7728:H2-Q10 UTSW 17 35,781,735 (GRCm39) missense probably damaging 0.98
R8172:H2-Q10 UTSW 17 35,781,996 (GRCm39) missense probably null 1.00
R8233:H2-Q10 UTSW 17 35,781,983 (GRCm39) missense probably benign 0.28
R8400:H2-Q10 UTSW 17 35,781,374 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCTTCTGCAGAGAGGG -3'
(R):5'- AGGCTCACATGGAAACTCTG -3'

Sequencing Primer
(F):5'- ACCAGGGAAGCCGCGTC -3'
(R):5'- ACATGGAAACTCTGCTCATTGC -3'
Posted On 2020-01-23