Incidental Mutation 'R8034:Pex6'
ID618154
Institutional Source Beutler Lab
Gene Symbol Pex6
Ensembl Gene ENSMUSG00000002763
Gene Nameperoxisomal biogenesis factor 6
SynonymsD130055I09Rik
Accession Numbers

Genbank: NM_145488; Ensembl: ENSMUSP00000002840

Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46711463-46725541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 46722399 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 616 (G616A)
Ref Sequence ENSEMBL: ENSMUSP00000002840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840] [ENSMUST00000002846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002840
AA Change: G616A

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763
AA Change: G616A

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000002846
SMART Domains Protein: ENSMUSP00000002846
Gene: ENSMUSG00000002769

DomainStartEndE-ValueType
Pfam:Methyltransf_23 27 217 9e-11 PFAM
Pfam:Methyltransf_31 56 224 1.3e-15 PFAM
Pfam:Methyltransf_18 57 176 1.5e-15 PFAM
Pfam:Methyltransf_25 61 169 1.4e-10 PFAM
Pfam:Methyltransf_12 62 171 4e-12 PFAM
Pfam:Methyltransf_11 62 173 2.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Pex6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Pex6 APN 17 46725304 missense probably benign 0.00
IGL01601:Pex6 APN 17 46723724 missense probably damaging 1.00
IGL01710:Pex6 APN 17 46725326 unclassified probably benign
IGL02392:Pex6 APN 17 46723499 missense probably damaging 1.00
IGL02419:Pex6 APN 17 46724435 missense possibly damaging 0.69
G5030:Pex6 UTSW 17 46715456 intron probably benign
R0091:Pex6 UTSW 17 46711918 missense probably damaging 1.00
R0243:Pex6 UTSW 17 46723737 critical splice donor site probably null
R0732:Pex6 UTSW 17 46724700 missense probably damaging 1.00
R1529:Pex6 UTSW 17 46714064 missense probably benign 0.10
R1602:Pex6 UTSW 17 46712137 missense probably benign 0.09
R1638:Pex6 UTSW 17 46722632 missense probably benign
R1757:Pex6 UTSW 17 46723498 missense probably damaging 1.00
R3769:Pex6 UTSW 17 46724385 unclassified probably null
R4684:Pex6 UTSW 17 46712101 missense probably benign 0.01
R4731:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4731:Pex6 UTSW 17 46724707 splice site probably null
R4732:Pex6 UTSW 17 46724707 splice site probably null
R4732:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4733:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4733:Pex6 UTSW 17 46724707 splice site probably null
R4915:Pex6 UTSW 17 46714056 missense probably damaging 0.96
R5996:Pex6 UTSW 17 46714458 splice site probably null
R6156:Pex6 UTSW 17 46720641 missense probably benign 0.02
R6227:Pex6 UTSW 17 46712108 missense probably benign 0.00
R7054:Pex6 UTSW 17 46720521 missense probably benign
R7635:Pex6 UTSW 17 46724017 missense probably damaging 1.00
Z1088:Pex6 UTSW 17 46712222 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTCCTGCACACCAAAGGCAG -3'
(R):5'- CCCTAGGGAGTTACACAAAAGGAC -3'

Sequencing Primer
(F):5'- AGCCATGCCAGACCTTGC -3'
(R):5'- TTACACAAAAGGACACATGGGTAG -3'
Posted On2020-01-23