Mutagenetix > Incidental Mutations

Incidental Mutation 'R8034:Pex6'

618154

Institutional Source

Beutler Lab

Gene Symbol

Pex6

Ensembl Gene

ENSMUSG00000002763

Gene Name

peroxisomal biogenesis factor 6

Synonyms

D130055I09Rik

Accession Numbers

Genbank: NM_145488; Ensembl: ENSMUSP00000002840

Is this an essential gene?

Possibly essential (E-score: 0.683) question?

Stock #

R8034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46711463-46725541 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 46722399 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Alanine at position 616 (G616A)

Ref Sequence

ENSEMBL: ENSMUSP00000002840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002840] [ENSMUST00000002846]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002840
AA Change: G616A

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763
AA Change: G616A

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	72	86	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	112	128	N/A	INTRINSIC
low complexity region	173	200	N/A	INTRINSIC
AAA	463	598	6.1e-7	SMART
AAA	737	875	6e-24	SMART
Blast:AAA	928	973	1e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000002846

SMART Domains

Protein: ENSMUSP00000002846
Gene: ENSMUSG00000002769

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_23	27	217	9e-11	PFAM
Pfam:Methyltransf_31	56	224	1.3e-15	PFAM
Pfam:Methyltransf_18	57	176	1.5e-15	PFAM
Pfam:Methyltransf_25	61	169	1.4e-10	PFAM
Pfam:Methyltransf_12	62	171	4e-12	PFAM
Pfam:Methyltransf_11	62	173	2.4e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Pex6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01478:Pex6	APN	17	46725304	missense	probably benign	0.00
IGL01601:Pex6	APN	17	46723724	missense	probably damaging	1.00
IGL01710:Pex6	APN	17	46725326	unclassified	probably benign
IGL02392:Pex6	APN	17	46723499	missense	probably damaging	1.00
IGL02419:Pex6	APN	17	46724435	missense	possibly damaging	0.69
G5030:Pex6	UTSW	17	46715456	intron	probably benign
R0091:Pex6	UTSW	17	46711918	missense	probably damaging	1.00
R0243:Pex6	UTSW	17	46723737	critical splice donor site	probably null
R0732:Pex6	UTSW	17	46724700	missense	probably damaging	1.00
R1529:Pex6	UTSW	17	46714064	missense	probably benign	0.10
R1602:Pex6	UTSW	17	46712137	missense	probably benign	0.09
R1638:Pex6	UTSW	17	46722632	missense	probably benign
R1757:Pex6	UTSW	17	46723498	missense	probably damaging	1.00
R3769:Pex6	UTSW	17	46724385	unclassified	probably null
R4684:Pex6	UTSW	17	46712101	missense	probably benign	0.01
R4731:Pex6	UTSW	17	46722288	missense	probably benign	0.02
R4731:Pex6	UTSW	17	46724707	splice site	probably null
R4732:Pex6	UTSW	17	46724707	splice site	probably null
R4732:Pex6	UTSW	17	46722288	missense	probably benign	0.02
R4733:Pex6	UTSW	17	46722288	missense	probably benign	0.02
R4733:Pex6	UTSW	17	46724707	splice site	probably null
R4915:Pex6	UTSW	17	46714056	missense	probably damaging	0.96
R5996:Pex6	UTSW	17	46714458	splice site	probably null
R6156:Pex6	UTSW	17	46720641	missense	probably benign	0.02
R6227:Pex6	UTSW	17	46712108	missense	probably benign	0.00
R7054:Pex6	UTSW	17	46720521	missense	probably benign
R7635:Pex6	UTSW	17	46724017	missense	probably damaging	1.00
Z1088:Pex6	UTSW	17	46712222	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTCCTGCACACCAAAGGCAG -3'
(R):5'- CCCTAGGGAGTTACACAAAAGGAC -3'

Sequencing Primer
(F):5'- AGCCATGCCAGACCTTGC -3'
(R):5'- TTACACAAAAGGACACATGGGTAG -3'

Posted On

2020-01-23