Incidental Mutation 'R8034:Lhcgr'
ID 618155
Institutional Source Beutler Lab
Gene Symbol Lhcgr
Ensembl Gene ENSMUSG00000024107
Gene Name luteinizing hormone/choriogonadotropin receptor
Synonyms LH-R, Lhr, Gpcr19-rs1
MMRRC Submission 067471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 89023909-89099418 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89049784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 581 (T581A)
Ref Sequence ENSEMBL: ENSMUSP00000024916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024916]
AlphaFold P30730
Predicted Effect probably damaging
Transcript: ENSMUST00000024916
AA Change: T581A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: T581A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 33 66 4.4e0 SMART
Pfam:LRR_5 155 273 2.9e-5 PFAM
Pfam:7tm_1 380 627 1.2e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,043,980 (GRCm39) T680A probably damaging Het
Asb3 C A 11: 31,031,554 (GRCm39) Y391* probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc80 A G 16: 44,943,238 (GRCm39) I783V probably damaging Het
Ccnf A G 17: 24,450,805 (GRCm39) V391A probably damaging Het
Cd5l C A 3: 87,273,271 (GRCm39) A80E possibly damaging Het
Chmp2b A T 16: 65,343,769 (GRCm39) M96K probably benign Het
Cspg4b A T 13: 113,479,045 (GRCm39) I1530F Het
Dennd4a T C 9: 64,795,850 (GRCm39) S725P probably benign Het
Dnah6 T C 6: 73,106,208 (GRCm39) N1843S probably damaging Het
Dpy19l3 A G 7: 35,449,281 (GRCm39) F41L probably benign Het
Eif3e A T 15: 43,135,703 (GRCm39) M112K probably benign Het
Faim T C 9: 98,874,786 (GRCm39) V111A possibly damaging Het
Fat1 A G 8: 45,404,728 (GRCm39) E493G probably benign Het
Fsip2 A G 2: 82,819,699 (GRCm39) D5144G possibly damaging Het
Fuz T C 7: 44,545,684 (GRCm39) M1T probably null Het
Ggcx T C 6: 72,405,587 (GRCm39) V529A possibly damaging Het
Gm7145 A T 1: 117,913,894 (GRCm39) T259S probably benign Het
Gria2 T G 3: 80,709,006 (GRCm39) T59P probably damaging Het
H2-Q10 A T 17: 35,781,338 (GRCm39) I47F probably damaging Het
Heatr6 A G 11: 83,644,735 (GRCm39) N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,345,180 (GRCm39) probably null Het
Ints7 GATCG GATCGTATCG 1: 191,345,183 (GRCm39) probably null Het
Lcn6 T A 2: 25,566,883 (GRCm39) L19* probably null Het
Map4k1 T C 7: 28,687,573 (GRCm39) I203T probably damaging Het
Mctp1 G C 13: 77,039,670 (GRCm39) L783F probably damaging Het
Mlf1 A T 3: 67,291,921 (GRCm39) M29L probably damaging Het
Npas3 T A 12: 53,687,312 (GRCm39) I159N probably damaging Het
Nup98 T C 7: 101,794,930 (GRCm39) probably null Het
Or4a39 A G 2: 89,237,081 (GRCm39) V114A probably benign Het
Or4m1 T C 14: 50,558,023 (GRCm39) K90E probably damaging Het
Or51h5 A T 7: 102,577,773 (GRCm39) K313* probably null Het
Or5b110-ps1 A G 19: 13,260,215 (GRCm39) F69S probably damaging Het
Or7d11 A G 9: 19,966,301 (GRCm39) F35L probably benign Het
Or8b41 T C 9: 38,054,973 (GRCm39) Y176H probably damaging Het
Otud3 T C 4: 138,623,111 (GRCm39) S377G probably benign Het
Pclo T A 5: 14,571,214 (GRCm39) S200T probably damaging Het
Pex6 G C 17: 47,033,325 (GRCm39) G616A possibly damaging Het
Pkhd1 T A 1: 20,451,662 (GRCm39) H2211L possibly damaging Het
Sec13 T C 6: 113,712,050 (GRCm39) K95R probably benign Het
Sema3c T C 5: 17,932,480 (GRCm39) V661A probably damaging Het
Sema5a A G 15: 32,574,987 (GRCm39) Y365C probably damaging Het
Sp140l2 T A 1: 85,231,881 (GRCm39) T180S probably benign Het
Sprr2h A T 3: 92,294,120 (GRCm39) E61V unknown Het
Tead3 A C 17: 28,552,203 (GRCm39) V365G probably damaging Het
Trpm7 T A 2: 126,688,119 (GRCm39) N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 (GRCm39) E13G probably benign Het
Zfp639 C A 3: 32,574,215 (GRCm39) A280E probably damaging Het
Other mutations in Lhcgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lhcgr APN 17 89,049,874 (GRCm39) missense probably benign
IGL00661:Lhcgr APN 17 89,057,546 (GRCm39) missense probably benign
IGL00840:Lhcgr APN 17 89,061,164 (GRCm39) splice site probably benign
IGL01434:Lhcgr APN 17 89,049,865 (GRCm39) missense probably damaging 1.00
IGL01489:Lhcgr APN 17 89,072,401 (GRCm39) splice site probably benign
IGL02077:Lhcgr APN 17 89,057,558 (GRCm39) missense probably benign 0.06
IGL02533:Lhcgr APN 17 89,049,838 (GRCm39) missense probably benign 0.00
IGL02948:Lhcgr APN 17 89,050,050 (GRCm39) missense probably damaging 1.00
capybara UTSW 17 89,050,014 (GRCm39) nonsense probably null
coro UTSW 17 89,049,677 (GRCm39) nonsense probably null
nutria UTSW 17 89,049,801 (GRCm39) missense probably damaging 1.00
R0101:Lhcgr UTSW 17 89,072,598 (GRCm39) missense probably damaging 1.00
R0101:Lhcgr UTSW 17 89,072,598 (GRCm39) missense probably damaging 1.00
R0556:Lhcgr UTSW 17 89,079,491 (GRCm39) missense probably damaging 0.99
R1824:Lhcgr UTSW 17 89,057,585 (GRCm39) missense probably benign 0.00
R1846:Lhcgr UTSW 17 89,072,575 (GRCm39) critical splice donor site probably null
R1852:Lhcgr UTSW 17 89,072,604 (GRCm39) missense probably damaging 0.99
R2352:Lhcgr UTSW 17 89,049,727 (GRCm39) missense possibly damaging 0.52
R3147:Lhcgr UTSW 17 89,065,771 (GRCm39) missense probably damaging 0.96
R3756:Lhcgr UTSW 17 89,061,284 (GRCm39) missense possibly damaging 0.77
R4180:Lhcgr UTSW 17 89,049,711 (GRCm39) missense probably damaging 1.00
R4540:Lhcgr UTSW 17 89,063,036 (GRCm39) missense probably benign
R4688:Lhcgr UTSW 17 89,072,580 (GRCm39) missense probably damaging 0.99
R4717:Lhcgr UTSW 17 89,049,895 (GRCm39) missense probably benign 0.00
R4723:Lhcgr UTSW 17 89,050,030 (GRCm39) missense probably benign 0.09
R4776:Lhcgr UTSW 17 89,050,125 (GRCm39) missense probably damaging 1.00
R4903:Lhcgr UTSW 17 89,049,789 (GRCm39) missense probably damaging 1.00
R5195:Lhcgr UTSW 17 89,050,374 (GRCm39) missense probably damaging 1.00
R5231:Lhcgr UTSW 17 89,063,039 (GRCm39) missense probably damaging 1.00
R5361:Lhcgr UTSW 17 89,050,281 (GRCm39) missense probably damaging 1.00
R5683:Lhcgr UTSW 17 89,079,447 (GRCm39) missense probably benign 0.00
R5758:Lhcgr UTSW 17 89,049,976 (GRCm39) missense probably damaging 0.99
R5929:Lhcgr UTSW 17 89,050,436 (GRCm39) nonsense probably null
R5987:Lhcgr UTSW 17 89,063,006 (GRCm39) missense probably damaging 1.00
R6268:Lhcgr UTSW 17 89,050,132 (GRCm39) missense probably damaging 1.00
R6477:Lhcgr UTSW 17 89,049,801 (GRCm39) missense probably damaging 1.00
R6610:Lhcgr UTSW 17 89,077,307 (GRCm39) missense possibly damaging 0.93
R7234:Lhcgr UTSW 17 89,099,359 (GRCm39) missense possibly damaging 0.96
R7282:Lhcgr UTSW 17 89,065,811 (GRCm39) missense probably benign
R7320:Lhcgr UTSW 17 89,049,506 (GRCm39) missense probably benign
R7398:Lhcgr UTSW 17 89,079,474 (GRCm39) missense probably benign 0.03
R7710:Lhcgr UTSW 17 89,050,210 (GRCm39) missense probably damaging 1.00
R8108:Lhcgr UTSW 17 89,049,478 (GRCm39) nonsense probably null
R8150:Lhcgr UTSW 17 89,049,677 (GRCm39) nonsense probably null
R8151:Lhcgr UTSW 17 89,049,677 (GRCm39) nonsense probably null
R8236:Lhcgr UTSW 17 89,050,014 (GRCm39) nonsense probably null
R8901:Lhcgr UTSW 17 89,063,030 (GRCm39) missense probably damaging 1.00
R8916:Lhcgr UTSW 17 89,061,170 (GRCm39) critical splice donor site probably null
R9632:Lhcgr UTSW 17 89,049,532 (GRCm39) missense probably benign
R9716:Lhcgr UTSW 17 89,050,446 (GRCm39) missense probably damaging 1.00
U24488:Lhcgr UTSW 17 89,079,513 (GRCm39) critical splice acceptor site probably null
X0028:Lhcgr UTSW 17 89,050,150 (GRCm39) missense probably damaging 1.00
Z1176:Lhcgr UTSW 17 89,049,698 (GRCm39) missense probably damaging 1.00
Z1177:Lhcgr UTSW 17 89,072,409 (GRCm39) critical splice donor site probably null
Z1177:Lhcgr UTSW 17 89,061,333 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGTAAAGTTCAGCCCGGTG -3'
(R):5'- GGAATCCACTCTGTCACAAGTC -3'

Sequencing Primer
(F):5'- GCTTACAGCAACCAAATCTGCTCAG -3'
(R):5'- ACAAGTCTACATATTATCCATCTTGC -3'
Posted On 2020-01-23