Mutagenetix > Incidental Mutation

Incidental Mutation 'R8034:Lhcgr'

618155

Institutional Source

Beutler Lab

Gene Symbol

Lhcgr

Ensembl Gene

ENSMUSG00000024107

Gene Name

luteinizing hormone/choriogonadotropin receptor

Synonyms

Lhr, LH-R, Gpcr19-rs1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88741549-88791976 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88742356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 581 (T581A)

Ref Sequence

ENSEMBL: ENSMUSP00000024916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024916]

AlphaFold

P30730

Predicted Effect

probably damaging
Transcript: ENSMUST00000024916
AA Change: T581A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: T581A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	33	66	4.4e0	SMART
Pfam:LRR_5	155	273	2.9e-5	PFAM
Pfam:7tm_1	380	627	1.2e-29	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
BC067074	A	T	13: 113,342,511	I1530F		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in Lhcgr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Lhcgr	APN	17	88742446	missense	probably benign
IGL00661:Lhcgr	APN	17	88750118	missense	probably benign
IGL00840:Lhcgr	APN	17	88753736	splice site	probably benign
IGL01434:Lhcgr	APN	17	88742437	missense	probably damaging	1.00
IGL01489:Lhcgr	APN	17	88764973	splice site	probably benign
IGL02077:Lhcgr	APN	17	88750130	missense	probably benign	0.06
IGL02533:Lhcgr	APN	17	88742410	missense	probably benign	0.00
IGL02948:Lhcgr	APN	17	88742622	missense	probably damaging	1.00
capybara	UTSW	17	88742586	nonsense	probably null
coro	UTSW	17	88742249	nonsense	probably null
nutria	UTSW	17	88742373	missense	probably damaging	1.00
R0101:Lhcgr	UTSW	17	88765170	missense	probably damaging	1.00
R0101:Lhcgr	UTSW	17	88765170	missense	probably damaging	1.00
R0556:Lhcgr	UTSW	17	88772063	missense	probably damaging	0.99
R1824:Lhcgr	UTSW	17	88750157	missense	probably benign	0.00
R1846:Lhcgr	UTSW	17	88765147	critical splice donor site	probably null
R1852:Lhcgr	UTSW	17	88765176	missense	probably damaging	0.99
R2352:Lhcgr	UTSW	17	88742299	missense	possibly damaging	0.52
R3147:Lhcgr	UTSW	17	88758343	missense	probably damaging	0.96
R3756:Lhcgr	UTSW	17	88753856	missense	possibly damaging	0.77
R4180:Lhcgr	UTSW	17	88742283	missense	probably damaging	1.00
R4540:Lhcgr	UTSW	17	88755608	missense	probably benign
R4688:Lhcgr	UTSW	17	88765152	missense	probably damaging	0.99
R4717:Lhcgr	UTSW	17	88742467	missense	probably benign	0.00
R4723:Lhcgr	UTSW	17	88742602	missense	probably benign	0.09
R4776:Lhcgr	UTSW	17	88742697	missense	probably damaging	1.00
R4903:Lhcgr	UTSW	17	88742361	missense	probably damaging	1.00
R5195:Lhcgr	UTSW	17	88742946	missense	probably damaging	1.00
R5231:Lhcgr	UTSW	17	88755611	missense	probably damaging	1.00
R5361:Lhcgr	UTSW	17	88742853	missense	probably damaging	1.00
R5683:Lhcgr	UTSW	17	88772019	missense	probably benign	0.00
R5758:Lhcgr	UTSW	17	88742548	missense	probably damaging	0.99
R5929:Lhcgr	UTSW	17	88743008	nonsense	probably null
R5987:Lhcgr	UTSW	17	88755578	missense	probably damaging	1.00
R6268:Lhcgr	UTSW	17	88742704	missense	probably damaging	1.00
R6477:Lhcgr	UTSW	17	88742373	missense	probably damaging	1.00
R6610:Lhcgr	UTSW	17	88769879	missense	possibly damaging	0.93
R7234:Lhcgr	UTSW	17	88791931	missense	possibly damaging	0.96
R7282:Lhcgr	UTSW	17	88758383	missense	probably benign
R7320:Lhcgr	UTSW	17	88742078	missense	probably benign
R7398:Lhcgr	UTSW	17	88772046	missense	probably benign	0.03
R7710:Lhcgr	UTSW	17	88742782	missense	probably damaging	1.00
R8108:Lhcgr	UTSW	17	88742050	nonsense	probably null
R8150:Lhcgr	UTSW	17	88742249	nonsense	probably null
R8151:Lhcgr	UTSW	17	88742249	nonsense	probably null
R8236:Lhcgr	UTSW	17	88742586	nonsense	probably null
R8901:Lhcgr	UTSW	17	88755602	missense	probably damaging	1.00
R8916:Lhcgr	UTSW	17	88753742	critical splice donor site	probably null
R9632:Lhcgr	UTSW	17	88742104	missense	probably benign
R9716:Lhcgr	UTSW	17	88743018	missense	probably damaging	1.00
U24488:Lhcgr	UTSW	17	88772085	critical splice acceptor site	probably null
X0028:Lhcgr	UTSW	17	88742722	missense	probably damaging	1.00
Z1176:Lhcgr	UTSW	17	88742270	missense	probably damaging	1.00
Z1177:Lhcgr	UTSW	17	88753905	missense	probably benign	0.00
Z1177:Lhcgr	UTSW	17	88764981	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTGTAAAGTTCAGCCCGGTG -3'
(R):5'- GGAATCCACTCTGTCACAAGTC -3'

Sequencing Primer
(F):5'- GCTTACAGCAACCAAATCTGCTCAG -3'
(R):5'- ACAAGTCTACATATTATCCATCTTGC -3'

Posted On

2020-01-23