Incidental Mutation 'R8035:Gm8251'
ID618157
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8035 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44061551 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 129 (V129A)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168641
AA Change: V129A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: V129A

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,553,280 V938A probably damaging Het
Acot7 A G 4: 152,253,154 T254A possibly damaging Het
Ankle2 C T 5: 110,254,452 R943C probably damaging Het
Arrdc2 T C 8: 70,839,382 K7R probably benign Het
Arsi T A 18: 60,916,370 H108Q probably damaging Het
Asap3 T C 4: 136,241,203 Y689H probably benign Het
Bnip3 G A 7: 138,891,937 T181I probably damaging Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccdc6 A G 10: 70,097,501 I68V probably benign Het
Ccr3 T C 9: 124,028,975 F116L probably benign Het
Cdh9 G T 15: 16,831,066 V330F probably damaging Het
Cdkn1a T C 17: 29,099,376 C155R possibly damaging Het
Ctr9 C T 7: 111,034,457 A165V probably damaging Het
Cyp2b19 G A 7: 26,771,250 G439R probably damaging Het
Fam161b A T 12: 84,348,656 D504E probably damaging Het
Fdps G T 3: 89,095,476 P122T probably benign Het
Fmn2 T C 1: 174,719,871 Y1454H probably damaging Het
Gipc2 T C 3: 152,094,229 E288G probably damaging Het
Gm21411 A C 4: 146,897,710 probably null Het
Hnrnpc C T 14: 52,084,262 D32N possibly damaging Het
Hspa12b T A 2: 131,140,939 I239N probably damaging Het
Hspb8 T C 5: 116,415,426 N138D probably damaging Het
Igkv4-69 T C 6: 69,283,937 I69V possibly damaging Het
Itih1 A C 14: 30,942,525 D81E probably benign Het
Kdm3b T C 18: 34,808,728 L624S probably damaging Het
Klk6 A G 7: 43,828,662 M153V probably benign Het
Lgals9 A T 11: 78,963,476 Y327* probably null Het
Lims1 T A 10: 58,410,441 probably benign Het
Lrp1b T A 2: 40,860,655 I3080F Het
Mars2 C T 1: 55,238,297 T353I possibly damaging Het
Matn4 T C 2: 164,397,040 N307S probably damaging Het
Mettl17 C T 14: 51,891,490 H406Y probably damaging Het
Mtor T A 4: 148,546,399 M2271K probably benign Het
Myt1 T C 2: 181,795,739 L81P probably damaging Het
Olfr1474 T C 19: 13,471,899 F310L probably benign Het
Olfr424 A T 1: 174,136,924 Y60F probably damaging Het
Olfr681 T A 7: 105,121,550 L31H probably damaging Het
Olfr885 C T 9: 38,061,665 T115I probably damaging Het
Pbrm1 A G 14: 31,084,152 K1030R probably damaging Het
Rap1gds1 A T 3: 139,015,550 D119E probably damaging Het
Rgs9 A G 11: 109,273,324 I151T probably benign Het
Skiv2l2 T C 13: 112,898,802 E539G probably benign Het
Slc26a7 A C 4: 14,621,338 M16R possibly damaging Het
Slx4ip T G 2: 137,044,025 Y88* probably null Het
Sppl2c T A 11: 104,187,366 W331R probably benign Het
Srcap T C 7: 127,542,612 S1855P probably benign Het
Svs2 A G 2: 164,237,133 F285L probably benign Het
Tjp1 G T 7: 65,342,702 A76E probably benign Het
Trip13 G C 13: 73,913,254 A430G probably benign Het
Trpm6 A G 19: 18,792,862 E337G probably damaging Het
Vmn1r37 T A 6: 66,731,393 M1K probably null Het
Wdr72 T G 9: 74,179,501 probably benign Het
Zcchc6 A T 13: 59,789,190 N1214K probably benign Het
Zfp583 T C 7: 6,316,772 K414E probably damaging Het
Zfp940 A C 7: 29,845,523 S320A probably benign Het
Zfp979 A C 4: 147,613,306 C315W probably damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
R8523:Gm8251 UTSW 1 44060834 missense possibly damaging 0.86
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCAACTACATTACGGTGTCTTG -3'
(R):5'- GGAAAAGTCATGCTTCTGAGAG -3'

Sequencing Primer
(F):5'- ACATTACGGTGTCTTGTTCTTTCTTG -3'
(R):5'- ATGCTTCTGAGAGAAACATGTTC -3'
Posted On2020-01-23