Incidental Mutation 'R8035:Slx4ip'
ID618163
Institutional Source Beutler Lab
Gene Symbol Slx4ip
Ensembl Gene ENSMUSG00000027281
Gene NameSLX4 interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8035 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location136891218-137071950 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 137044025 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 88 (Y88*)
Ref Sequence ENSEMBL: ENSMUSP00000096914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028737] [ENSMUST00000099311] [ENSMUST00000180277]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028737
AA Change: I48S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028737
Gene: ENSMUSG00000027281
AA Change: I48S

DomainStartEndE-ValueType
low complexity region 271 292 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099311
AA Change: Y88*
SMART Domains Protein: ENSMUSP00000096914
Gene: ENSMUSG00000027281
AA Change: Y88*

DomainStartEndE-ValueType
Pfam:UPF0492 10 365 6.4e-170 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180277
AA Change: Y88*
SMART Domains Protein: ENSMUSP00000136131
Gene: ENSMUSG00000027281
AA Change: Y88*

DomainStartEndE-ValueType
low complexity region 341 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,553,280 V938A probably damaging Het
Acot7 A G 4: 152,253,154 T254A possibly damaging Het
Ankle2 C T 5: 110,254,452 R943C probably damaging Het
Arrdc2 T C 8: 70,839,382 K7R probably benign Het
Arsi T A 18: 60,916,370 H108Q probably damaging Het
Asap3 T C 4: 136,241,203 Y689H probably benign Het
Bnip3 G A 7: 138,891,937 T181I probably damaging Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccdc6 A G 10: 70,097,501 I68V probably benign Het
Ccr3 T C 9: 124,028,975 F116L probably benign Het
Cdh9 G T 15: 16,831,066 V330F probably damaging Het
Cdkn1a T C 17: 29,099,376 C155R possibly damaging Het
Ctr9 C T 7: 111,034,457 A165V probably damaging Het
Cyp2b19 G A 7: 26,771,250 G439R probably damaging Het
Fam161b A T 12: 84,348,656 D504E probably damaging Het
Fdps G T 3: 89,095,476 P122T probably benign Het
Fmn2 T C 1: 174,719,871 Y1454H probably damaging Het
Gipc2 T C 3: 152,094,229 E288G probably damaging Het
Gm21411 A C 4: 146,897,710 probably null Het
Gm8251 A G 1: 44,061,551 V129A possibly damaging Het
Hnrnpc C T 14: 52,084,262 D32N possibly damaging Het
Hspa12b T A 2: 131,140,939 I239N probably damaging Het
Hspb8 T C 5: 116,415,426 N138D probably damaging Het
Igkv4-69 T C 6: 69,283,937 I69V possibly damaging Het
Itih1 A C 14: 30,942,525 D81E probably benign Het
Kdm3b T C 18: 34,808,728 L624S probably damaging Het
Klk6 A G 7: 43,828,662 M153V probably benign Het
Lgals9 A T 11: 78,963,476 Y327* probably null Het
Lims1 T A 10: 58,410,441 probably benign Het
Lrp1b T A 2: 40,860,655 I3080F Het
Mars2 C T 1: 55,238,297 T353I possibly damaging Het
Matn4 T C 2: 164,397,040 N307S probably damaging Het
Mettl17 C T 14: 51,891,490 H406Y probably damaging Het
Mtor T A 4: 148,546,399 M2271K probably benign Het
Myt1 T C 2: 181,795,739 L81P probably damaging Het
Olfr1474 T C 19: 13,471,899 F310L probably benign Het
Olfr424 A T 1: 174,136,924 Y60F probably damaging Het
Olfr681 T A 7: 105,121,550 L31H probably damaging Het
Olfr885 C T 9: 38,061,665 T115I probably damaging Het
Pbrm1 A G 14: 31,084,152 K1030R probably damaging Het
Rap1gds1 A T 3: 139,015,550 D119E probably damaging Het
Rgs9 A G 11: 109,273,324 I151T probably benign Het
Skiv2l2 T C 13: 112,898,802 E539G probably benign Het
Slc26a7 A C 4: 14,621,338 M16R possibly damaging Het
Sppl2c T A 11: 104,187,366 W331R probably benign Het
Srcap T C 7: 127,542,612 S1855P probably benign Het
Svs2 A G 2: 164,237,133 F285L probably benign Het
Tjp1 G T 7: 65,342,702 A76E probably benign Het
Trip13 G C 13: 73,913,254 A430G probably benign Het
Trpm6 A G 19: 18,792,862 E337G probably damaging Het
Vmn1r37 T A 6: 66,731,393 M1K probably null Het
Wdr72 T G 9: 74,179,501 probably benign Het
Zcchc6 A T 13: 59,789,190 N1214K probably benign Het
Zfp583 T C 7: 6,316,772 K414E probably damaging Het
Zfp940 A C 7: 29,845,523 S320A probably benign Het
Zfp979 A C 4: 147,613,306 C315W probably damaging Het
Other mutations in Slx4ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Slx4ip APN 2 137044055 nonsense probably null
IGL01546:Slx4ip APN 2 137066199 missense probably benign
IGL02114:Slx4ip APN 2 137000200 missense probably damaging 1.00
IGL02142:Slx4ip APN 2 137068022 missense possibly damaging 0.87
IGL02253:Slx4ip APN 2 137000275 critical splice donor site probably null
IGL02826:Slx4ip APN 2 137004973 missense probably damaging 1.00
IGL03035:Slx4ip APN 2 137067703 missense possibly damaging 0.50
IGL03261:Slx4ip APN 2 137046739 missense probably benign 0.01
R0561:Slx4ip UTSW 2 137066170 missense probably null 0.27
R1750:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R1774:Slx4ip UTSW 2 137067723 missense probably damaging 0.99
R1812:Slx4ip UTSW 2 137068195 missense probably benign 0.13
R1894:Slx4ip UTSW 2 137068118 missense probably benign 0.02
R1961:Slx4ip UTSW 2 137067681 missense probably benign 0.02
R2051:Slx4ip UTSW 2 137066205 missense possibly damaging 0.90
R2263:Slx4ip UTSW 2 137044015 missense probably damaging 1.00
R2914:Slx4ip UTSW 2 137067591 critical splice acceptor site probably null
R3798:Slx4ip UTSW 2 137067623 missense probably benign 0.19
R4061:Slx4ip UTSW 2 137005017 missense probably benign 0.08
R4934:Slx4ip UTSW 2 137068347 utr 3 prime probably benign
R4944:Slx4ip UTSW 2 137046767 missense probably benign 0.17
R5061:Slx4ip UTSW 2 137044010 missense probably damaging 1.00
R5465:Slx4ip UTSW 2 137004947 missense probably damaging 1.00
R5609:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R6112:Slx4ip UTSW 2 137046744 missense probably damaging 1.00
R6391:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R6525:Slx4ip UTSW 2 137000218 missense possibly damaging 0.72
R6868:Slx4ip UTSW 2 137000210 missense probably damaging 1.00
R6944:Slx4ip UTSW 2 137068275 missense probably damaging 1.00
R6966:Slx4ip UTSW 2 137068224 missense probably damaging 0.96
R7214:Slx4ip UTSW 2 137046730 missense probably benign 0.15
R7406:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R7711:Slx4ip UTSW 2 137067994 missense probably damaging 1.00
R8181:Slx4ip UTSW 2 137000184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAGTGTGATAACATTGCTC -3'
(R):5'- AGCTCTCTGTTTTCATGGGC -3'

Sequencing Primer
(F):5'- AGTGTGATAACATTGCTCTCTCCAC -3'
(R):5'- GATACCTTACCAGTATTCTGG -3'
Posted On2020-01-23