Incidental Mutation 'R8035:Zfp583'
ID618182
Institutional Source Beutler Lab
Gene Symbol Zfp583
Ensembl Gene ENSMUSG00000030443
Gene Namezinc finger protein 583
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R8035 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location6315660-6331285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6316772 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 414 (K414E)
Ref Sequence ENSEMBL: ENSMUSP00000053935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062765] [ENSMUST00000108560] [ENSMUST00000165705]
Predicted Effect probably damaging
Transcript: ENSMUST00000062765
AA Change: K414E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053935
Gene: ENSMUSG00000030443
AA Change: K414E

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108560
AA Change: K414E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104200
Gene: ENSMUSG00000030443
AA Change: K414E

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165705
AA Change: K414E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129551
Gene: ENSMUSG00000030443
AA Change: K414E

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Meta Mutation Damage Score 0.5835 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,553,280 V938A probably damaging Het
Acot7 A G 4: 152,253,154 T254A possibly damaging Het
Ankle2 C T 5: 110,254,452 R943C probably damaging Het
Arrdc2 T C 8: 70,839,382 K7R probably benign Het
Arsi T A 18: 60,916,370 H108Q probably damaging Het
Asap3 T C 4: 136,241,203 Y689H probably benign Het
Bnip3 G A 7: 138,891,937 T181I probably damaging Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccdc6 A G 10: 70,097,501 I68V probably benign Het
Ccr3 T C 9: 124,028,975 F116L probably benign Het
Cdh9 G T 15: 16,831,066 V330F probably damaging Het
Cdkn1a T C 17: 29,099,376 C155R possibly damaging Het
Ctr9 C T 7: 111,034,457 A165V probably damaging Het
Cyp2b19 G A 7: 26,771,250 G439R probably damaging Het
Fam161b A T 12: 84,348,656 D504E probably damaging Het
Fdps G T 3: 89,095,476 P122T probably benign Het
Fmn2 T C 1: 174,719,871 Y1454H probably damaging Het
Gipc2 T C 3: 152,094,229 E288G probably damaging Het
Gm21411 A C 4: 146,897,710 probably null Het
Gm8251 A G 1: 44,061,551 V129A possibly damaging Het
Hnrnpc C T 14: 52,084,262 D32N possibly damaging Het
Hspa12b T A 2: 131,140,939 I239N probably damaging Het
Hspb8 T C 5: 116,415,426 N138D probably damaging Het
Igkv4-69 T C 6: 69,283,937 I69V possibly damaging Het
Itih1 A C 14: 30,942,525 D81E probably benign Het
Kdm3b T C 18: 34,808,728 L624S probably damaging Het
Klk6 A G 7: 43,828,662 M153V probably benign Het
Lgals9 A T 11: 78,963,476 Y327* probably null Het
Lims1 T A 10: 58,410,441 probably benign Het
Lrp1b T A 2: 40,860,655 I3080F Het
Mars2 C T 1: 55,238,297 T353I possibly damaging Het
Matn4 T C 2: 164,397,040 N307S probably damaging Het
Mettl17 C T 14: 51,891,490 H406Y probably damaging Het
Mtor T A 4: 148,546,399 M2271K probably benign Het
Myt1 T C 2: 181,795,739 L81P probably damaging Het
Olfr1474 T C 19: 13,471,899 F310L probably benign Het
Olfr424 A T 1: 174,136,924 Y60F probably damaging Het
Olfr681 T A 7: 105,121,550 L31H probably damaging Het
Olfr885 C T 9: 38,061,665 T115I probably damaging Het
Pbrm1 A G 14: 31,084,152 K1030R probably damaging Het
Rap1gds1 A T 3: 139,015,550 D119E probably damaging Het
Rgs9 A G 11: 109,273,324 I151T probably benign Het
Skiv2l2 T C 13: 112,898,802 E539G probably benign Het
Slc26a7 A C 4: 14,621,338 M16R possibly damaging Het
Slx4ip T G 2: 137,044,025 Y88* probably null Het
Sppl2c T A 11: 104,187,366 W331R probably benign Het
Srcap T C 7: 127,542,612 S1855P probably benign Het
Svs2 A G 2: 164,237,133 F285L probably benign Het
Tjp1 G T 7: 65,342,702 A76E probably benign Het
Trip13 G C 13: 73,913,254 A430G probably benign Het
Trpm6 A G 19: 18,792,862 E337G probably damaging Het
Vmn1r37 T A 6: 66,731,393 M1K probably null Het
Wdr72 T G 9: 74,179,501 probably benign Het
Zcchc6 A T 13: 59,789,190 N1214K probably benign Het
Zfp940 A C 7: 29,845,523 S320A probably benign Het
Zfp979 A C 4: 147,613,306 C315W probably damaging Het
Other mutations in Zfp583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp583 APN 7 6317185 missense probably damaging 1.00
IGL01921:Zfp583 APN 7 6325570 missense possibly damaging 0.95
R1593:Zfp583 UTSW 7 6317009 missense probably benign 0.03
R2188:Zfp583 UTSW 7 6317611 missense probably benign
R4377:Zfp583 UTSW 7 6317681 missense possibly damaging 0.61
R5000:Zfp583 UTSW 7 6325474 missense probably damaging 1.00
R5031:Zfp583 UTSW 7 6317398 missense probably benign
R5723:Zfp583 UTSW 7 6323675 missense probably damaging 0.98
R6603:Zfp583 UTSW 7 6325476 missense probably damaging 1.00
R7325:Zfp583 UTSW 7 6316586 missense probably damaging 0.99
R7391:Zfp583 UTSW 7 6316499 missense probably damaging 1.00
R7673:Zfp583 UTSW 7 6317010 missense possibly damaging 0.91
R8127:Zfp583 UTSW 7 6323822 splice site probably null
R8331:Zfp583 UTSW 7 6317555 missense probably benign
RF024:Zfp583 UTSW 7 6316982 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGATGTGCACGCTGCC -3'
(R):5'- GTTCATTCCTGGCCCAGCATC -3'

Sequencing Primer
(F):5'- TCTCTGATGTAGGGTAAGAGATCCAC -3'
(R):5'- TGAGAAACCGTATGTGTGCC -3'
Posted On2020-01-23