Incidental Mutation 'R8035:Rgs9'
ID618197
Institutional Source Beutler Lab
Gene Symbol Rgs9
Ensembl Gene ENSMUSG00000020599
Gene Nameregulator of G-protein signaling 9
SynonymsRgs9-2, RGS9-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8035 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location109225355-109298129 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109273324 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 151 (I151T)
Ref Sequence ENSEMBL: ENSMUSP00000020920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020920] [ENSMUST00000106704] [ENSMUST00000106706]
PDB Structure
The multifunctional nature of Gbeta5/RGS9 revealed from its crystal structure [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020920
AA Change: I151T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020920
Gene: ENSMUSG00000020599
AA Change: I151T

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
low complexity region 486 504 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106704
AA Change: I151T

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102315
Gene: ENSMUSG00000020599
AA Change: I151T

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
Blast:G_gamma 154 229 4e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106706
AA Change: I151T

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102317
Gene: ENSMUSG00000020599
AA Change: I151T

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, relative to wild-type, homozygous null photoreceptors display abnormally retarded recovery of their light responses, and slowed rates of GTP hydrolysis by transducin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,553,280 V938A probably damaging Het
Acot7 A G 4: 152,253,154 T254A possibly damaging Het
Ankle2 C T 5: 110,254,452 R943C probably damaging Het
Arrdc2 T C 8: 70,839,382 K7R probably benign Het
Arsi T A 18: 60,916,370 H108Q probably damaging Het
Asap3 T C 4: 136,241,203 Y689H probably benign Het
Bnip3 G A 7: 138,891,937 T181I probably damaging Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccdc6 A G 10: 70,097,501 I68V probably benign Het
Ccr3 T C 9: 124,028,975 F116L probably benign Het
Cdh9 G T 15: 16,831,066 V330F probably damaging Het
Cdkn1a T C 17: 29,099,376 C155R possibly damaging Het
Ctr9 C T 7: 111,034,457 A165V probably damaging Het
Cyp2b19 G A 7: 26,771,250 G439R probably damaging Het
Fam161b A T 12: 84,348,656 D504E probably damaging Het
Fdps G T 3: 89,095,476 P122T probably benign Het
Fmn2 T C 1: 174,719,871 Y1454H probably damaging Het
Gipc2 T C 3: 152,094,229 E288G probably damaging Het
Gm21411 A C 4: 146,897,710 probably null Het
Gm8251 A G 1: 44,061,551 V129A possibly damaging Het
Hnrnpc C T 14: 52,084,262 D32N possibly damaging Het
Hspa12b T A 2: 131,140,939 I239N probably damaging Het
Hspb8 T C 5: 116,415,426 N138D probably damaging Het
Igkv4-69 T C 6: 69,283,937 I69V possibly damaging Het
Itih1 A C 14: 30,942,525 D81E probably benign Het
Kdm3b T C 18: 34,808,728 L624S probably damaging Het
Klk6 A G 7: 43,828,662 M153V probably benign Het
Lgals9 A T 11: 78,963,476 Y327* probably null Het
Lrp1b T A 2: 40,860,655 I3080F Het
Mars2 C T 1: 55,238,297 T353I possibly damaging Het
Matn4 T C 2: 164,397,040 N307S probably damaging Het
Mettl17 C T 14: 51,891,490 H406Y probably damaging Het
Mtor T A 4: 148,546,399 M2271K probably benign Het
Myt1 T C 2: 181,795,739 L81P probably damaging Het
Olfr1474 T C 19: 13,471,899 F310L probably benign Het
Olfr424 A T 1: 174,136,924 Y60F probably damaging Het
Olfr681 T A 7: 105,121,550 L31H probably damaging Het
Olfr885 C T 9: 38,061,665 T115I probably damaging Het
Pbrm1 A G 14: 31,084,152 K1030R probably damaging Het
Rap1gds1 A T 3: 139,015,550 D119E probably damaging Het
Skiv2l2 T C 13: 112,898,802 E539G probably benign Het
Slc26a7 A C 4: 14,621,338 M16R possibly damaging Het
Slx4ip T G 2: 137,044,025 Y88* probably null Het
Sppl2c T A 11: 104,187,366 W331R probably benign Het
Srcap T C 7: 127,542,612 S1855P probably benign Het
Svs2 A G 2: 164,237,133 F285L probably benign Het
Tjp1 G T 7: 65,342,702 A76E probably benign Het
Trip13 G C 13: 73,913,254 A430G probably benign Het
Trpm6 A G 19: 18,792,862 E337G probably damaging Het
Vmn1r37 T A 6: 66,731,393 M1K probably null Het
Zcchc6 A T 13: 59,789,190 N1214K probably benign Het
Zfp583 T C 7: 6,316,772 K414E probably damaging Het
Zfp940 A C 7: 29,845,523 S320A probably benign Het
Zfp979 A C 4: 147,613,306 C315W probably damaging Het
Other mutations in Rgs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Rgs9 APN 11 109249049 splice site probably benign
IGL01949:Rgs9 APN 11 109259834 critical splice donor site probably null
IGL02479:Rgs9 APN 11 109225652 missense possibly damaging 0.51
IGL03170:Rgs9 APN 11 109259855 missense probably benign 0.10
R1368:Rgs9 UTSW 11 109248151 missense probably benign 0.00
R1499:Rgs9 UTSW 11 109268921 critical splice donor site probably null
R1780:Rgs9 UTSW 11 109239499 nonsense probably null
R2422:Rgs9 UTSW 11 109225777 critical splice acceptor site probably null
R2509:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2510:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2511:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R3932:Rgs9 UTSW 11 109275813 splice site probably benign
R4179:Rgs9 UTSW 11 109281448 critical splice donor site probably null
R4801:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4802:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4928:Rgs9 UTSW 11 109225744 missense probably benign 0.08
R5073:Rgs9 UTSW 11 109227331 missense probably benign 0.03
R5209:Rgs9 UTSW 11 109239594 critical splice acceptor site probably null
R5286:Rgs9 UTSW 11 109239451 splice site probably null
R5449:Rgs9 UTSW 11 109225744 missense probably benign
R6046:Rgs9 UTSW 11 109239560 missense probably damaging 1.00
R6267:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R6296:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R7325:Rgs9 UTSW 11 109276581 missense probably damaging 1.00
R7453:Rgs9 UTSW 11 109227268 missense probably damaging 1.00
R7864:Rgs9 UTSW 11 109275620 missense probably damaging 1.00
R7947:Rgs9 UTSW 11 109275620 missense probably damaging 1.00
Z1177:Rgs9 UTSW 11 109239592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGCCTGGTGTTTATCAC -3'
(R):5'- AAGAGACCTGCTGCAAAGGC -3'

Sequencing Primer
(F):5'- CCAACCTGGATTACTTGGGACTAG -3'
(R):5'- TGTCTGGCCCCCTTTATGG -3'
Posted On2020-01-23