Incidental Mutation 'R8035:Skiv2l2'
ID618201
Institutional Source Beutler Lab
Gene Symbol Skiv2l2
Ensembl Gene ENSMUSG00000016018
Gene Namesuperkiller viralicidic activity 2-like 2 (S. cerevisiae)
Synonyms2610528A15Rik
Accession Numbers

Ncbi RefSeq: NM_028151.2; MGI:1919448

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8035 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location112867418-112927398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112898802 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 539 (E539G)
Ref Sequence ENSEMBL: ENSMUSP00000022281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022281]
Predicted Effect probably benign
Transcript: ENSMUST00000022281
AA Change: E539G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022281
Gene: ENSMUSG00000016018
AA Change: E539G

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DEXDc 134 317 6.42e-34 SMART
HELICc 437 526 3.14e-19 SMART
Pfam:rRNA_proc-arch 580 839 1.7e-91 PFAM
DSHCT 863 1040 1.69e-96 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,553,280 V938A probably damaging Het
Acot7 A G 4: 152,253,154 T254A possibly damaging Het
Ankle2 C T 5: 110,254,452 R943C probably damaging Het
Arrdc2 T C 8: 70,839,382 K7R probably benign Het
Arsi T A 18: 60,916,370 H108Q probably damaging Het
Asap3 T C 4: 136,241,203 Y689H probably benign Het
Bnip3 G A 7: 138,891,937 T181I probably damaging Het
C87436 T C 6: 86,447,355 S290P probably benign Het
Ccdc6 A G 10: 70,097,501 I68V probably benign Het
Ccr3 T C 9: 124,028,975 F116L probably benign Het
Cdh9 G T 15: 16,831,066 V330F probably damaging Het
Cdkn1a T C 17: 29,099,376 C155R possibly damaging Het
Ctr9 C T 7: 111,034,457 A165V probably damaging Het
Cyp2b19 G A 7: 26,771,250 G439R probably damaging Het
Fam161b A T 12: 84,348,656 D504E probably damaging Het
Fdps G T 3: 89,095,476 P122T probably benign Het
Fmn2 T C 1: 174,719,871 Y1454H probably damaging Het
Gipc2 T C 3: 152,094,229 E288G probably damaging Het
Gm21411 A C 4: 146,897,710 probably null Het
Gm8251 A G 1: 44,061,551 V129A possibly damaging Het
Hnrnpc C T 14: 52,084,262 D32N possibly damaging Het
Hspa12b T A 2: 131,140,939 I239N probably damaging Het
Hspb8 T C 5: 116,415,426 N138D probably damaging Het
Igkv4-69 T C 6: 69,283,937 I69V possibly damaging Het
Itih1 A C 14: 30,942,525 D81E probably benign Het
Kdm3b T C 18: 34,808,728 L624S probably damaging Het
Klk6 A G 7: 43,828,662 M153V probably benign Het
Lgals9 A T 11: 78,963,476 Y327* probably null Het
Lrp1b T A 2: 40,860,655 I3080F Het
Mars2 C T 1: 55,238,297 T353I possibly damaging Het
Matn4 T C 2: 164,397,040 N307S probably damaging Het
Mettl17 C T 14: 51,891,490 H406Y probably damaging Het
Mtor T A 4: 148,546,399 M2271K probably benign Het
Myt1 T C 2: 181,795,739 L81P probably damaging Het
Olfr1474 T C 19: 13,471,899 F310L probably benign Het
Olfr424 A T 1: 174,136,924 Y60F probably damaging Het
Olfr681 T A 7: 105,121,550 L31H probably damaging Het
Olfr885 C T 9: 38,061,665 T115I probably damaging Het
Pbrm1 A G 14: 31,084,152 K1030R probably damaging Het
Rap1gds1 A T 3: 139,015,550 D119E probably damaging Het
Rgs9 A G 11: 109,273,324 I151T probably benign Het
Slc26a7 A C 4: 14,621,338 M16R possibly damaging Het
Slx4ip T G 2: 137,044,025 Y88* probably null Het
Sppl2c T A 11: 104,187,366 W331R probably benign Het
Srcap T C 7: 127,542,612 S1855P probably benign Het
Svs2 A G 2: 164,237,133 F285L probably benign Het
Tjp1 G T 7: 65,342,702 A76E probably benign Het
Trip13 G C 13: 73,913,254 A430G probably benign Het
Trpm6 A G 19: 18,792,862 E337G probably damaging Het
Vmn1r37 T A 6: 66,731,393 M1K probably null Het
Zcchc6 A T 13: 59,789,190 N1214K probably benign Het
Zfp583 T C 7: 6,316,772 K414E probably damaging Het
Zfp940 A C 7: 29,845,523 S320A probably benign Het
Zfp979 A C 4: 147,613,306 C315W probably damaging Het
Other mutations in Skiv2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Skiv2l2 APN 13 112914489 missense probably damaging 1.00
IGL01772:Skiv2l2 APN 13 112891325 missense probably benign 0.10
IGL01843:Skiv2l2 APN 13 112918561 splice site probably benign
IGL01972:Skiv2l2 APN 13 112881061 missense probably damaging 1.00
IGL02451:Skiv2l2 APN 13 112891347 missense probably damaging 1.00
IGL02716:Skiv2l2 APN 13 112883146 missense probably benign 0.13
IGL03234:Skiv2l2 APN 13 112880975 splice site probably benign
K3955:Skiv2l2 UTSW 13 112910979 nonsense probably null
P0038:Skiv2l2 UTSW 13 112910979 nonsense probably null
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0086:Skiv2l2 UTSW 13 112927328 missense probably benign 0.00
R0687:Skiv2l2 UTSW 13 112914361 missense probably damaging 1.00
R1216:Skiv2l2 UTSW 13 112914342 splice site probably benign
R1218:Skiv2l2 UTSW 13 112917622 missense probably damaging 1.00
R1312:Skiv2l2 UTSW 13 112883251 nonsense probably null
R1827:Skiv2l2 UTSW 13 112913099 critical splice donor site probably null
R1852:Skiv2l2 UTSW 13 112872927 missense probably benign 0.00
R1889:Skiv2l2 UTSW 13 112887490 missense probably benign 0.00
R2205:Skiv2l2 UTSW 13 112898890 missense probably benign 0.06
R2256:Skiv2l2 UTSW 13 112876512 missense probably damaging 0.98
R2394:Skiv2l2 UTSW 13 112883168 missense probably benign 0.02
R3717:Skiv2l2 UTSW 13 112895595 missense probably damaging 1.00
R3779:Skiv2l2 UTSW 13 112903392 splice site probably benign
R4613:Skiv2l2 UTSW 13 112921739 nonsense probably null
R4939:Skiv2l2 UTSW 13 112909892 missense possibly damaging 0.91
R5452:Skiv2l2 UTSW 13 112913181 missense probably null 0.96
R5591:Skiv2l2 UTSW 13 112927356 start codon destroyed probably null 0.88
R5688:Skiv2l2 UTSW 13 112873056 nonsense probably null
R5761:Skiv2l2 UTSW 13 112917662 missense probably damaging 0.96
R5789:Skiv2l2 UTSW 13 112891285 missense probably benign 0.01
R5851:Skiv2l2 UTSW 13 112908952 missense probably damaging 1.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6348:Skiv2l2 UTSW 13 112910917 missense possibly damaging 0.88
R7276:Skiv2l2 UTSW 13 112914439 missense probably benign 0.00
R7397:Skiv2l2 UTSW 13 112921686 missense probably benign
R7792:Skiv2l2 UTSW 13 112872909 missense probably benign 0.02
R7863:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7946:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7948:Skiv2l2 UTSW 13 112921762 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGCTATAGACTATCAACCCATTT -3'
(R):5'- CTTTGTTTACCAAAAGTCCATGTTT -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2020-01-23